Primaryamine

3,5-Diamino-6-chloro-N-(N-4-[4-(2,3-dihydroxypropoxy)phenyl]butylcarbamimidoyl)pyrazine-2-carboxam (CAS 587879-54-7)

Product Name : 3,5-Diamino-6-chloro-N-(N-4-butylcarbamimidoyl)pyrazine-2-carboxam (CAS 587879-54-7)Synonym : Application : CAS: 587879-54-7Purity: Molecular Weight: 548.01Formula : C20H30ClN7O7SPhysical state: solubility : Shipping Condition : Melting point: SMILES: CS(=O)(=O)O.90965-06-3 Description C1=CC(=CC=C1CCCCN=C(N)NC(=O)C2=C(N=C(C(=N2)Cl)N)N)OCC(CO)OReferences: 7787-69-1 site…

3-(5-Chloro-2,4-dimethoxy-phenylsulfamoyl)-benzoic acid

Product Name : 3-(5-Chloro-2,4-dimethoxy-phenylsulfamoyl)-benzoic acidSynonym : Application : MF: C15H14ClNO6S, MW: 371.79CAS: Purity: Molecular Weight: 371.79Formula : C15H14ClNO6SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES:…

3-(5,7-dimethyl[1,2,4]triazolo[1,5-a]pyrimidin-2-yl)propan-1-ol

Product Name : 3-(5,7-dimethyltriazolopyrimidin-2-yl)propan-1-olSynonym : Application : CAS: Purity: Molecular Weight: 206.3483-12-3 Computational Chemistry Data 24Formula : C10H14N4OPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: 146.111525-71-4…

3-[5-(2,6-difluorophenyl)-1,3-oxazol-2-yl]propanoic acid

Product Name : 3-propanoic acidSynonym : Application : MF: C12H9F2NO3, MW: 253.2CAS: Purity: Molecular Weight: 253.2Formula : C12H9F2NO3Physical state: solubility : Shipping Condition : Store at room temperatureMelting point: 143.564483-18-7…

3-(4-sec-Butyl-5-mercapto-4H-[1,2,4]triazol-3-yl)-N,N-diethyl-benzenesulfonamide

Product Name : 3-(4-sec-Butyl-5-mercapto-4H-triazol-3-yl)-N,N-diethyl-benzenesulfonamideSynonym : Application : MF: C16H24N4O2S2, MW: 368.67460-86-0 Description 52CAS: Purity: Molecular Weight: 368.7211-39-4 Synonym 52Formula : C16H24N4O2S2Physical state: solubility : Shipping Condition : Store at room…

3-(4-Methoxybenzylidineamino)benzeneboronic acid pinacol ester (CAS 380151-91-7)

Product Name : 3-(4-Methoxybenzylidineamino)benzeneboronic acid pinacol ester (CAS 380151-91-7)Synonym : Application : CAS: 380151-91-7Purity: Molecular Weight: 337.39065-95-7 Computational Chemistry Data 22Formula : C20H24BNO3Physical state: solubility : Shipping Condition : Melting…

3,4-Dinitrophenol, wetted (CAS 577-71-9)

Product Name : 3,4-Dinitrophenol, wetted (CAS 577-71-9)Synonym : Application : CAS: 577-71-9Purity: Molecular Weight: 184.19230-27-4 manufacturer 11Formula : C6H4N2O5Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point:…

3,4-Dimethoxyphenylboronic acid (CAS 122775-35-3)

Product Name : 3,4-Dimethoxyphenylboronic acid (CAS 122775-35-3)Synonym : 3,4-Dimethoxybenzeneboronic AcidApplication : 3,4-Dimethoxyphenylboronic acid is a compound for proteomics research useCAS: 122775-35-3Purity: Molecular Weight: 181.98Formula : C8H11BO4Physical state: Solidsolubility : Shipping…

3,4-Dihydro-6,7-dimethoxy-3-oxo-2-quinoxalinepropanoic Acid (CAS 99208-26-1)

Product Name : 3,4-Dihydro-6,7-dimethoxy-3-oxo-2-quinoxalinepropanoic Acid (CAS 99208-26-1)Synonym : 3-(6,7-DIMETHOXY-3-OXO-3,4-DIHYDRO-QUINOXALIN-2-YL)-PROPIONIC ACIDApplication : 3,4-Dihydro-6,7-dimethoxy-3-oxo-2-quinoxalinepropanoic Acid is an intermediate in the production of DMEQ-TADCAS: 99208-26-1Purity: Molecular Weight: 278.26Formula : C13H14N2O5Physical state: solubility :…

3,4-Diethoxyphenylacetonitrile (CAS 27472-21-5)

Product Name : 3,4-Diethoxyphenylacetonitrile (CAS 27472-21-5)Synonym : Application : CAS: 27472-21-5Purity: Molecular Weight: 205.25Formula : C12H15NO2Physical state: solubility : Shipping Condition : Melting point: SMILES: References: 1489-69-6 manufacturer 18871-66-4 Molecular…

3,4-Dichlorophenyldipropionamide (CAS 954-24-5)

Product Name : 3,4-Dichlorophenyldipropionamide (CAS 954-24-5)Synonym : Application : CAS: 954-24-5Purity: Molecular Weight: 274.14Formula : C12H13Cl2NO2Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CCC(=O)N(C1=CC(=C(C=C1)Cl)Cl)C(=O)CCReferences: 10102-05-3…

3-(4-Chloro-pyrazol-1-yl)-2-methyl-propionic acid (CAS 957301-84-7)

Product Name : 3-(4-Chloro-pyrazol-1-yl)-2-methyl-propionic acid (CAS 957301-84-7)Synonym : Application : 3-(4-Chloro-pyrazol-1-yl)-2-methyl-propionic acid is a pyrazole compound for proteomics researchCAS: 957301-84-7Purity: Molecular Weight: 188.61Formula : C7H9ClN2O2Physical state: Solidsolubility : Shipping Condition…

3-(4-Chlorophenyl)azetidine

Product Name : 3-(4-Chlorophenyl)azetidineSynonym : Application : CAS: Purity: Molecular Weight: Formula : Physical state: solubility : Shipping Condition : Melting point: SMILES: References: 7758-89-6 web 166881-42-1 supplier PMID:33459877

3-(4-Chloro-3-nitro-phenyl)-3-oxo-propionic acid methyl ester

Product Name : 3-(4-Chloro-3-nitro-phenyl)-3-oxo-propionic acid methyl esterSynonym : Application : CAS: Purity: Molecular Weight: 257.63Formula : C10H8ClNO5Physical state: solubility : Shipping Condition : Melting point: 132.1194-18-9 Safety Information 35° C…

3,4,5-Trimethoxybenzaldehyde-d3 (CAS 1219805-17-0 (unlabeled))

Product Name : 3,4,5-Trimethoxybenzaldehyde-d3 (CAS 1219805-17-0 (unlabeled))Synonym : Application : CAS: 1219805-17-0 (unlabeled)Purity: Molecular Weight: 199.278788-66-2 supplier 22Formula : C10H12O4Physical state: solubility : Shipping Condition : Melting point: SMILES: C()()Oc1c(cc(cc1OC)C=O)OCReferences:…

3,4,5-Trifluorobenzenesulfonamide (CAS 913472-55-6)

Product Name : 3,4,5-Trifluorobenzenesulfonamide (CAS 913472-55-6)Synonym : Application : CAS: 913472-55-6, MF: C6H4F3NO2S, MW: 211.16CAS: 913472-55-6Purity: Molecular Weight: 211.1892-57-5 Description 16Formula : C6H4F3NO2SPhysical state: Solidsolubility : Shipping Condition : Store…

3,4,5,6-Tetrachlorophthalimide (CAS 1571-13-7)

Product Name : 3,4,5,6-Tetrachlorophthalimide (CAS 1571-13-7)Synonym : Application : CAS: 1571-13-7Purity: Molecular Weight: 284.91Formula : C8HCl4NO2Physical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: C12=C(C(=C(C(=C1Cl)Cl)Cl)Cl)C(=O)NC2=OReferences: 77924-28-8…

1-[(4-bromophenyl)sulfonyl]piperidine-2-carboxylic acid

Product Name : 1-piperidine-2-carboxylic acidSynonym : Application : CAS: Purity: Molecular Weight: 348.12354-84-6 Computational Chemistry Data 21Formula : C12H14BrNO4SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point:…

3-(3-Nitro-pyrazol-1-yl)-propionic acid methyl ester

Product Name : 3-(3-Nitro-pyrazol-1-yl)-propionic acid methyl esterSynonym : Application : MF: C7H9N3O4, MW: 199.16CAS: Purity: Molecular Weight: 199.1462885-86-4 chemscene 16Formula : C7H9N3O4Physical state: Solidsolubility : Shipping Condition : Melting point:…

3-(3-(Dimethylamino)propylcarbamoyl)phenylboronic acid, pinacol ester (CAS 936250-16-7)

Product Name : 3-(3-(Dimethylamino)propylcarbamoyl)phenylboronic acid, pinacol ester (CAS 936250-16-7)Synonym : Application : CAS: 936250-16-7Purity: Molecular Weight: 332.843666-40-0 supplier 2Formula : C18H29BN2O3Physical state: Solidsolubility : Shipping Condition : Store at room…

1-(3-aminopropyl)azepan-2-one (CAS 24566-95-8)

Product Name : 1-(3-aminopropyl)azepan-2-one (CAS 24566-95-8)Synonym : Application : CAS: 24566-95-8Purity: Molecular Weight: 170.25Formula : C9H18N2OPhysical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point: 174-175° CSMILES: C1CCC(=O)N(CC1)CCCNReferences:…

3-[3-(4-ethoxyphenyl)-5-mercapto-4H-1,2,4-triazol-4-yl]propanoic acid

Product Name : 3-propanoic acidSynonym : Application : MF: C13H15N3O3S, MW: 293.34CAS: Purity: Molecular Weight: 293.34Formula : C13H15N3O3SPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: 225.1810-13-5…

1-[(4-bromobenzoyl)amino]cyclohexanecarboxylic acid

Product Name : 1-cyclohexanecarboxylic acidSynonym : Application : MF: C14H16BrNO3, MW: 326.19CAS: Purity: Molecular Weight: 326.19Formula : C14H16BrNO3Physical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES:…

3-[3-(2-furyl)-5-mercapto-4H-1,2,4-triazol-4-yl]propanamide

Product Name : 3-propanamideSynonym : Application : CAS: Purity: Molecular Weight: 238.27Formula : C9H10N4O2SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 184.163755-62-2 site 11° C (Predicted)SMILES:…

3-(2-Cyclohexylethoxy)pyrrolidine hydrochloride

Product Name : 3-(2-Cyclohexylethoxy)pyrrolidine hydrochlorideSynonym : Application : MF: C12H23NO•HCl, MW: 233.78CAS: Purity: Molecular Weight: 233.78Formula : C12H23NO•HClPhysical state: solubility : Shipping Condition : Melting point: SMILES: C1CCC(CC1)CCOC2CCNC2.194726-46-0 web ClReferences:…

3-(2-Chloroethyl)-2-methyl-4H-pyrido[1,2-a]pyrimidin-4-one (CAS 41078-70-0)

Product Name : 3-(2-Chloroethyl)-2-methyl-4H-pyridopyrimidin-4-one (CAS 41078-70-0)Synonym : 3-(2-Chloroethyl)-2-methylpyridopyrimidin-4-one; 3-(2-Chloroethyl)-2-methyl-4H-pyridopyrimidin-4-one;Application : 3-(2-Chloroethyl)-2-methyl-4H-pyridopyrimidin-4-one is 3-(2-Chloroethyl)-2-methyl-4H-pyridopyrimidin-4-one is an intermediary compound obtained in the synthesis of Risperidone.CAS: 41078-70-0Purity: Molecular Weight: 222.67Formula : C11H11ClN2OPhysical state:…

3-(2,5,7-trimethylpyrazolo[1,5-a]pyrimidin-6-yl)propanoic acid

Product Name : 3-(2,5,7-trimethylpyrazolopyrimidin-6-yl)propanoic acidSynonym : Application : CAS: Purity: Molecular Weight: 233.BuyMethyl 4-aminothiazole-5-carboxylate 27Formula : C12H15N3O2Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 250° CSMILES:…

3-(2,3-dihydro-1H-inden-5-ylsulfonyl)propanoic acid

Product Name : 3-(2,3-dihydro-1H-inden-5-ylsulfonyl)propanoic acidSynonym : Application : MF: C12H14O4S, MW: 254.3CAS: Purity: Molecular Weight: 254.3Formula : C12H14O4SPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: 169.4-Amino-2-fluoro-5-methoxybenzoic…

3-(1H,1H-Heptafluorobutoxy)propane-1,2-diol (CAS 25385-72-2)

Product Name : 3-(1H,1H-Heptafluorobutoxy)propane-1,2-diol (CAS 25385-72-2)Synonym : Application : CAS: 25385-72-2Purity: Molecular Weight: 274.13Formula : C7H9F7O3Physical state: solubility : Shipping Condition : Melting point: SMILES: C(C(COCC(C(C(F)(F)F)(F)F)(F)F)O)OReferences: Price of NH2-PEG2-C6-Cl Price…

1,3,5-Trimethylbenzene (CAS 108-67-8)

Product Name : 1,3,5-Trimethylbenzene (CAS 108-67-8)Synonym : Mesitylene; 3,5-DimethyltolueneApplication : 1,3,5-Trimethylbenzene is a precursor to 2,4,6-trimethylanilineCAS: 108-67-8Purity: ≥97%Molecular Weight: 120.19Formula : C9H12Physical state: Liquidsolubility : Shipping Condition : Store at…

3-(1,3-benzothiazol-2-ylamino)propanoic acid (CAS 104344-75-4)

Product Name : 3-(1,3-benzothiazol-2-ylamino)propanoic acid (CAS 104344-75-4)Synonym : Application : CAS: 104344-75-4, MF: C10H10N2O2S, MW: 222.26CAS: 104344-75-4Purity: Molecular Weight: 222.1380300-88-8 web 26Formula : C10H10N2O2SPhysical state: Solidsolubility : Shipping Condition :…

[[3-[(Dimethylamino)carbonyl]-2-pyridinyl]sulfonyl]-carbamic acid ethyl ester (CAS 144098-17-9)

Product Name : -2-pyridinyl]sulfonyl]-carbamic acid ethyl ester (CAS 144098-17-9)Synonym : 144098-17-9; AC-407; AKOS015914447; I14-41968; 2-(ethoxycarbylsulfamoyl)-N,N-dimethylnicotinamideApplication : CAS: 144098-17-9Purity: Molecular Weight: 301.32Formula : C11H15N3O5SPhysical state: solubility : Shipping Condition : Store…

3-[(anilinocarbonyl)amino]-4-chlorobenzoic acid

Product Name : 3--4-chlorobenzoic acidSynonym : Application : MW: 290.7CAS: Purity: Molecular Weight: Formula : Physical state: solubility : Shipping Condition : Melting point: SMILES: References: 2-Chloro-5-methoxypyridin-4-amine supplier 2,2-Bis(bromomethyl)-1,3-dioxolane In…

3-[(4-methyl-1,3-thiazol-2-yl)thio]methyl-1-benzofuran-2-carboxylic acid

Product Name : 3-methyl-1-benzofuran-2-carboxylic acidSynonym : Application : CAS: Purity: Molecular Weight: 305.37Formula : C14H11NO3S2Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CC1=CSC(=N1)SCC2=C(OC3=CC=CC=C32)C(=O)OReferences: BuyMethyl 1H-1,2,3-triazole-4-carboxylate…

3-[(2,3-Dimethyl-phenylcarbamoyl)-methyl]-4-oxo-thiazolidin-2-ylidene-acetic acid ethyl ester

Product Name : 3--4-oxo-thiazolidin-2-ylidene-acetic acid ethyl esterSynonym : Application : MF: C17H20N2O4S, MW: 348.42CAS: Purity: Molecular Weight: 348.42Formula : C17H20N2O4SPhysical state: solubility : Shipping Condition : Store at room temperatureMelting…

1-(3,5-Dihydroxyphenyl)-2-[(1,1-dimethylethyl)amino]-ethanone, Hydrochloride

Product Name : 1-(3,5-Dihydroxyphenyl)-2--ethanone, HydrochlorideSynonym : Application : CAS: Purity: Molecular Weight: 259.73Formula : C12H17NO3.3-Methyloxazolidine-2,5-dione Chemscene HClPhysical state: Solidsolubility : Soluble in DMSO, Methanol and WaterShipping Condition : Store at…

(2S,4R)-4-Fluoro-pyrrolidine-2-carboxylic acid (CAS 2507-61-1)

Product Name : (2S,4R)-4-Fluoro-pyrrolidine-2-carboxylic acid (CAS 2507-61-1)Synonym : Application : CAS: 2507-61-1Purity: Molecular Weight: 133.12Formula : C5H8FNO2Physical state: Solidsolubility : Soluble in water (0.Price of 1211586-09-2 1 g/ml, clear solution).Shipping…

(2S,3R,4E)-2-Butyrylamino-4-decene-1,3-diol (CAS 850264-01-6)

Product Name : (2S,3R,4E)-2-Butyrylamino-4-decene-1,3-diol (CAS 850264-01-6)Synonym : Application : CAS: 850264-01-6Purity: Molecular Weight: 257.Price of 1223105-51-8 37Formula : C14H27NO3Physical state: Solidsolubility : Soluble in Chloroform and MethanolShipping Condition : Store…

(2R)-2-[(1,3-benzodioxol-5-ylcarbonyl)amino]propanoic acid

Product Name : (2R)-2-propanoic acidSynonym : Application : MF: C11H11NO5, MW: 237.21CAS: Purity: Molecular Weight: 237.21Formula : C11H11NO5Physical state: solubility : Shipping Condition : Melting point: SMILES: C(C(=O)O)NC(=O)C1=CC2=C(C=C1)OCO2References: 3-Acetoxy-2-benzylpropanoic acid…

2′-Nitrophenyl 2,3-Di-O-acetyl-4-O-triethylsilyl-b-D-xylopyranoside (CAS 162088-90-6)

Product Name : 2′-Nitrophenyl 2,3-Di-O-acetyl-4-O-triethylsilyl-b-D-xylopyranoside (CAS 162088-90-6)Synonym : Application : CAS: 162088-90-6Purity: Molecular Weight: 469.56Formula : C21H31NO9SiPhysical state: Solidsolubility : Soluble in Chloroform, Ethyl Acetate and MethanolShipping Condition : Store…

2′-Deoxy-N2-methylguanosine (CAS 19916-77-9)

Product Name : 2′-Deoxy-N2-methylguanosine (CAS 19916-77-9)Synonym : 2′-Deoxy-N2-methyl-D-guanosine; N2-Methyl-2′-deoxyguanosineApplication : CAS: 19916-77-9Purity: Molecular Weight: 281.27Formula : C11H15N5O4Physical state: Solidsolubility : Shipping Condition : Store at 4° CMelting point: SMILES: COC1=NC(=NC2=C1N=CN23C((O3)CO)O)NReferences:…

2′-Chloro-2′-deoxycytidine (CAS 10212-19-8)

Product Name : 2′-Chloro-2′-deoxycytidine (CAS 10212-19-8)Synonym : Cytidine,2′-chloro-2′-deoxy- (8CI,9CI); 2-Chloro-2′-deoxycytidineApplication : 2′-Chloro-2′-deoxycytidine is a nucleoside derivativeCAS: 10212-19-8Purity: Molecular Weight: 261.RuPhos Pd G2 Chemscene 70Formula : C9H12ClN3O4Physical state: Solidsolubility : Shipping…

2′,4′-Diethoxyacetophenone (CAS 22924-18-1)

Product Name : 2′,4′-Diethoxyacetophenone (CAS 22924-18-1)Synonym : Application : CAS: 22924-18-1Purity: Molecular Weight: 208.25Formula : C12H16O3Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 68-70° CSMILES: CCOC1=CC(=C(C=C1)C(=O)C)OCCReferences:…

(2E)-3-amino-2-(2-amino-1,3-thiazol-4-yl)but-2-enenitrile

Product Name : (2E)-3-amino-2-(2-amino-1,3-thiazol-4-yl)but-2-enenitrileSynonym : Application : MF: C7H8N4S, MW: 180.23CAS: Purity: Molecular Weight: 180.23Formula : C7H8N4SPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: 134.6-Bromo-3-methoxy-1H-indazole Purity…

2′,3′,5′-Tri-O-benzoyl-2-thiouridine (CAS 21052-18-6)

Product Name : 2′,3′,5′-Tri-O-benzoyl-2-thiouridine (CAS 21052-18-6)Synonym : 2-Thiouridine 2′,3′,5′-TribenzoateApplication : 2′,3′,5′-Tri-O-benzoyl-2-thiouridine is a protected 2-ThiouridineCAS: 21052-18-6Purity: Molecular Weight: 572.59Formula : C30H24N2O8SPhysical state: solubility : Shipping Condition : Melting point: SMILES:…

(2E)-3-(4-hydroxy-3-methoxyphenyl)-2-phenylacrylic acid

Product Name : (2E)-3-(4-hydroxy-3-methoxyphenyl)-2-phenylacrylic acidSynonym : Application : CAS: Purity: Molecular Weight: 270.28Formula : C16H14O4Physical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: COC1=C(C=CC(=C1)/C=C(\C2=CC=CC=C2)/C(=O)O)OReferences: 7-Bromo-4-methyl-2H-1,4-benzoxazin-3-one custom…

[1-(3,4-dichlorophenyl)-3,5-dimethyl-1H-pyrazol-4-yl]acetic acid

Product Name : acetic acidSynonym : Application : MF: C13H12Cl2N2O2, MW: 299.15CAS: Purity: Molecular Weight: 299.6-Fluorobenzofuran-2-carboxylic acid Purity 15Formula : C13H12Cl2N2O2Physical state: solubility : Shipping Condition : Store at room…

(2E)-2-(hydroxyimino)-N-(4-methoxyphenyl)acetamide

Product Name : (2E)-2-(hydroxyimino)-N-(4-methoxyphenyl)acetamideSynonym : Application : MF: C9H10N2O3, MW: 194.19CAS: Purity: Molecular Weight: 194.1,2,3,4-Tetrahydrobenzoquinoline Price 19Formula : C9H10N2O3Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point:…

25-Desacetyl Rifapentin (CAS 79039-56-8)

Product Name : 25-Desacetyl Rifapentin (CAS 79039-56-8)Synonym : 3-methyl]-25-O-deacetyl-rifamycin; 25-Deacetylrifapentine; L 14583Application : 25-Desacetyl Rifapentin is a metabolite of Rifapentine.CAS: 79039-56-8Purity: Molecular Weight: 834.Price of 2-Chloro-1,7-naphthyridin-8(7H)-one 99Formula : C45H62N4O11Physical state:…

21-Deoxycortisol (CAS 641-77-0)

Product Name : 21-Deoxycortisol (CAS 641-77-0)Synonym : 11β,17α-Dihydroxy-4-pregnene-3,20-dione; 11β,17α-Dihydroxyprogesterone; 21-DesoxycortisolApplication : CAS: 641-77-0Purity: Molecular Weight: 346.46Formula : C21H30O4Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES:…

2-Trimethylsilyl-1-ethylboronic acid pinacol ester (CAS 165904-20-1)

Product Name : 2-Trimethylsilyl-1-ethylboronic acid pinacol ester (CAS 165904-20-1)Synonym : Application : CAS: 165904-20-1, MF: C11H25BO2Si, MW: 228.21CAS: 165904-20-1Purity: Molecular Weight: 228.21Formula : C11H25BO2SiPhysical state: solubility : Shipping Condition :…

2-(Trifluoromethyl)benzenesulfonyl chloride (CAS 776-04-5)

Product Name : 2-(Trifluoromethyl)benzenesulfonyl chloride (CAS 776-04-5)Synonym : Application : CAS: 776-04-5Purity: Molecular Weight: 244.62Formula : CF3C6H4SO2ClPhysical state: solubility : Shipping Condition : Melting point: SMILES: FC(F)(F)C1=CC=CC=C1S(Cl)(=O)=OReferences: 1,2-Oxathiolane 2,2-dioxide Chemscene…

2-(Trifluoromethyl)-1,4-phenylenediamine (CAS 364-13-6)

Product Name : 2-(Trifluoromethyl)-1,4-phenylenediamine (CAS 364-13-6)Synonym : Application : CAS: 364-13-6Purity: Molecular Weight: 176.14Formula : C7H7F3N2Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: NC1=CC=C(N)C(=C1)C(F)(F)FReferences: 1234616-36-4…

1-[(3-methylphenyl)methyl]piperidin-4-amine

Product Name : 1-piperidin-4-amineSynonym : Application : CAS: Purity: Molecular Weight: 204.31Formula : C13H20N2Physical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CC1=CC(=CC=C1)CN2CCC(CC2)NReferences: 2-Bromooxazole uses 898552-72-2…

2-Thiazolylzinc bromide solution (CAS 173382-28-0)

Product Name : 2-Thiazolylzinc bromide solution (CAS 173382-28-0)Synonym : Application : CAS: 173382-28-0Purity: Molecular Weight: 229.41Formula : C3H2BrNSZnPhysical state: Liquidsolubility : Shipping Condition : Store at 4° CMelting point: SMILES:…

2-Pyridineboronic acid (CAS 197958-29-5)

Product Name : 2-Pyridineboronic acid (CAS 197958-29-5)Synonym : Pyridine-2-boronic acidApplication : CAS: 197958-29-5Purity: Molecular Weight: 122.92Formula : C5H6BNO2Physical state: Solidsolubility : Shipping Condition : Store at -20° CMelting point: 110-140°…

2-(propane-1-sulfonamido)benzoic acid

Product Name : 2-(propane-1-sulfonamido)benzoic acidSynonym : Application : MF: C10H13NO4S, MW: 243.28CAS: Purity: Molecular Weight: 243.28Formula : C10H13NO4SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES:…

2′-Thioadenosine (CAS 60239-18-1 (non-salt))

Product Name : 2′-Thioadenosine (CAS 60239-18-1 (non-salt))Synonym : Application : 2′-Thioadenosine is a potent, selective inhibitor of ErbB1/ErbB2CAS: 60239-18-1 (non-salt)Purity: Molecular Weight: 283.3Formula : C10H13N5O3SPhysical state: Solidsolubility : Soluble in…

2-Phenylimidazole (CAS 670-96-2)

Product Name : 2-Phenylimidazole (CAS 670-96-2)Synonym : Application : 2-Phenylimidazole is used to prepare complex compounds with ruthenium(III).CAS: 670-96-2Purity: Molecular Weight: 144.Buy22112-84-1 17Formula : C9H8N2Physical state: Solidsolubility : Shipping Condition…

2-phenyl-N-(piperidin-4-yl)acetamide hydrochloride

Product Name : 2-phenyl-N-(piperidin-4-yl)acetamide hydrochlorideSynonym : Application : CAS: Purity: Molecular Weight: Formula : Physical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: C1CNCCC1NC(=O)CC2=CC=CC=C2.(2-(Aminomethyl)phenyl)boronic acid web…

2-(p-Toluenesulfonylamino)phenylboronic acid pinacol ester (CAS 796061-07-9)

Product Name : 2-(p-Toluenesulfonylamino)phenylboronic acid pinacol ester (CAS 796061-07-9)Synonym : Application : CAS: 796061-07-9, MF: C19H24BNO4S, MW: 373.27CAS: 796061-07-9Purity: Molecular Weight: 373.27Formula : C19H24BNO4SPhysical state: solubility : Shipping Condition :…

(2-oxo-5-phenyl-1,3,4-oxadiazol-3(2H)-yl)acetic acid (CAS 71679-70-4)

Product Name : (2-oxo-5-phenyl-1,3,4-oxadiazol-3(2H)-yl)acetic acid (CAS 71679-70-4)Synonym : Application : CAS: 71679-70-4, MF: C10H8N2O4, MW: 220.1211521-17-3 Data Sheet 18CAS: 71679-70-4Purity: Molecular Weight: 220.Methyl 6-formylnicotinate structure 18Formula : C10H8N2O4Physical state: Solidsolubility…

2-Oxopropyltriphenylphosphonium chloride (CAS 1235-21-8)

Product Name : 2-Oxopropyltriphenylphosphonium chloride (CAS 1235-21-8)Synonym : Application : CAS: 1235-21-8Purity: Molecular Weight: 354.81Formula : C21H20ClOPPhysical state: Solidsolubility : Shipping Condition : Melting point: SMILES: Cl.4-Amino-7-bromoisoindolin-1-one site CC(=O)CP(C1=CC=CC=C1)(C1=CC=CC=C1)C1=CC=CC=C1References: 2-Hydroxy-5-iodobenzonitrile…

2-Nitrophenyl 2,3,4-Tri-O-acetyl-β-D-glucuronide, Methyl Ester (CAS 55274-44-7)

Product Name : 2-Nitrophenyl 2,3,4-Tri-O-acetyl-β-D-glucuronide, Methyl Ester (CAS 55274-44-7)Synonym : Application : CAS: 55274-44-7Purity: Molecular Weight: 455.(E)-3-(Thiazol-4-yl)acrylic acid Chemscene 37Formula : C19H21NO12Physical state: solubility : Soluble in Acetone and MethanolShipping…

2-Nitronaphthalene (CAS 581-89-5)

Product Name : 2-Nitronaphthalene (CAS 581-89-5)Synonym : Application : CAS: 581-89-5Purity: Molecular Weight: 173.17Formula : C10H7NO2Physical state: Solidsolubility : Shipping Condition : Store at 4° CMelting point: 65-73° CSMILES: (=O)C1=CC2=CC=CC=C2C=C1References:…

2-Nitrofluorene (CAS 607-57-8)

Product Name : 2-Nitrofluorene (CAS 607-57-8)Synonym : 2-Nitro-9H-fluoreneApplication : 2-Nitrofluorene is a nitrated polycyclic aromatic hydrocarbonCAS: 607-57-8Purity: ≥97%Molecular Weight: 211.22Formula : C13H9NO2Physical state: Solidsolubility : Shipping Condition : Store at…

2-Naphthyl acrylate (CAS 52684-34-1)

Product Name : 2-Naphthyl acrylate (CAS 52684-34-1)Synonym : Application : 2-Naphthyl acrylate is a fluorescent monomerCAS: 52684-34-1Purity: Molecular Weight: 198.22Formula : C13H10O2Physical state: Solidsolubility : Shipping Condition : Store at…

2-N2-[N6-(4-Azido-2,3,5,6-tetrafluorobenzoyl)-6 -aminocaproyl]-N6-(6-biotinamidocaproyl)-L -lysinylamido] Ethyl 2-Carboxyethyl Disulfide

Product Name : 2-N2--N6-(6-biotinamidocaproyl)-L -lysinylamido] Ethyl 2-Carboxyethyl DisulfideSynonym : Application : CAS: Purity: Molecular Weight: 979.2908-71-6 custom synthesis 14Formula : C40H58F4N10O8S3Physical state: Solidsolubility : Soluble in DMF and DMSOShipping Condition…

2-Methylthiophenylboronic acid, pinacol ester (CAS 1072945-09-5)

Product Name : 2-Methylthiophenylboronic acid, pinacol ester (CAS 1072945-09-5)Synonym : 2-(Methylthio)phenylboronic acid pinacolate; 4,4,5,5-Tetramethyl-2-(2-methylsulfanylphenyl)-1,3,2-dioxaborolaneApplication : 2-Methylthiophenylboronic acid, pinacol ester is a substituted boronic acid compound for proteomics researchCAS: 1072945-09-5Purity: Molecular…

2-Methyloxazole-4-carboxaldehyde (CAS 113732-84-6)

Product Name : 2-Methyloxazole-4-carboxaldehyde (CAS 113732-84-6)Synonym : Application : CAS: 113732-84-6Purity: Molecular Weight: 111.10Formula : C5H5NO2Physical state: Solidsolubility : Shipping Condition : Store at 4° CMelting point: 70-75° CSMILES: CC1=NC(=CO1)C=OReferences:…

2-Methylcyclohexanol, mixture of cis and trans (CAS 583-59-5)

Product Name : 2-Methylcyclohexanol, mixture of cis and trans (CAS 583-59-5)Synonym : Application : 2-Methylcyclohexanol, mixture of cis and trans is used to study the effect of organic solvents on…

2-methylalaninamide (CAS 16252-90-7)

Product Name : 2-methylalaninamide (CAS 16252-90-7)Synonym : Application : 2-methylalaninamide is a specialty product for proteomics researchCAS: 16252-90-7Purity: Molecular Weight: 102.14Formula : C4H10N2OPhysical state: Solidsolubility : Shipping Condition : Melting…

2-methyl-5-(1,3,4-oxadiazol-2-yl)aniline

Product Name : 2-methyl-5-(1,3,4-oxadiazol-2-yl)anilineSynonym : Application : MF: C9H9N3O, MW: 175.19CAS: Purity: Molecular Weight: 175.19Formula : C9H9N3OPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CC1=C(C=C(C=C1)C2=NN=CO2)NReferences:…

2-Methyl-5-nitroaniline (CAS 99-55-8)

Product Name : 2-Methyl-5-nitroaniline (CAS 99-55-8)Synonym : 5-Nitro-o-toluidine; 2-Amino-4-nitrotolueneApplication : CAS: 99-55-8Purity: ≥97%Molecular Weight: 152.15Formula : C7H8N2O2Physical state: Solidsolubility : Insoluble in water.Shipping Condition : Store at 4° CMelting point:…

2-Methyl-4-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzonitrile (CAS 775351-54-7)

Product Name : 2-Methyl-4-(4,4,5,5-tetramethyl-dioxaborolan-2-yl)-benzonitrile (CAS 775351-54-7)Synonym : Application : CAS: 775351-54-7Purity: Molecular Weight: Formula : Physical state: solubility : Shipping Condition : Melting point: SMILES: B1(OC(C(O1)(C)C)(C)C)C2=CC(=C(C=C2)C#N)CReferences: Chloroiridic acid Chemscene Price…

2-Methyl-3-buten-2-ol (CAS 115-18-4)

Product Name : 2-Methyl-3-buten-2-ol (CAS 115-18-4)Synonym : Application : CAS: 115-18-4, MF: C5H10O, MW: 86.13, Purity: ≥98%CAS: 115-18-4Purity: ≥98%Molecular Weight: 86.13Formula : C5H10OPhysical state: Liquidsolubility : Shipping Condition : Store…

2-Methoxytetrahydropyran (CAS 6581-66-4)

Product Name : 2-Methoxytetrahydropyran (CAS 6581-66-4)Synonym : Application : CAS: 6581-66-4, MF: C6H12O2, MW: 116.16CAS: 6581-66-4Purity: Molecular Weight: 116.158326-85-3 custom synthesis 16Formula : C6H12O2Physical state: solubility : Shipping Condition :…

2-methoxycyclohexan-1-amine (CAS 4342-43-2)

Product Name : 2-methoxycyclohexan-1-amine (CAS 4342-43-2)Synonym : Application : CAS: 4342-43-2, MF: C7H15NO, MW: 129.2CAS: 4342-43-2Purity: Molecular Weight: 129.2Formula : C7H15NOPhysical state: solubility : Shipping Condition : Store at room…

2-Methoxy-6-methylaniline (CAS 50868-73-0)

Product Name : 2-Methoxy-6-methylaniline (CAS 50868-73-0)Synonym : Application : 2-Methoxy-6-methylaniline is 2-Methoxy-6-methylaniline may be used in the synthesis of 7-methoxy-1H-indazole, an inhibitor of nitric oxide synthase.CAS: 50868-73-0Purity: Molecular Weight: 137.18Formula…

1-(2-Morpholin-4-yl-ethyl)-1H-pyrrole-2-carbaldehyde

Product Name : 1-(2-Morpholin-4-yl-ethyl)-1H-pyrrole-2-carbaldehydeSynonym : Application : CAS: Purity: Molecular Weight: 208.26Formula : C11H16N2O2Physical state: solubility : Shipping Condition : Melting point: SMILES: C1COCCN1CCN2C=CC=C2C=OReferences: Price of 136092-76-7 Ethyl 2-cyano-2-(hydroxyimino)acetate Data…

2-Mercaptobenzothiazole zinc salt (CAS 155-04-4)

Product Name : 2-Mercaptobenzothiazole zinc salt (CAS 155-04-4)Synonym : BantexApplication : CAS: 155-04-4, MF: C14H8N2S4Zn, MW: 397.88CAS: 155-04-4Purity: Molecular Weight: 397.N-Boc-O-tosyl hydroxylamine Chemical name 88Formula : C14H8N2S4ZnPhysical state: Solidsolubility :…

2-mercapto-1-propyl-1H-benzimidazole-5-sulfonamide

Product Name : 2-mercapto-1-propyl-1H-benzimidazole-5-sulfonamideSynonym : Application : MF: C10H13N3O2S2, MW: 271.36CAS: Purity: Molecular Weight: 271.926280-83-3 site 36Formula : C10H13N3O2S2Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point:…

[(2-isopropyl-5-methylcyclohexyl)oxy]acetic acid (CAS 40248-63-3)

Product Name : acetic acid (CAS 40248-63-3)Synonym : Application : CAS: 40248-63-3, MF: C12H22O3, MW: 214.3CAS: 40248-63-3Purity: Molecular Weight: 214.3Formula : C12H22O3Physical state: solubility : Shipping Condition : Store at…

2-Hydroxysaclofen (CAS 117354-64-0)

Product Name : 2-Hydroxysaclofen (CAS 117354-64-0)Synonym : (RS)-3-Amino-2-(4-chlorophenyl)-2-hydroxypropyl-sulfonic acidApplication : 2-Hydroxysaclofen is a selective GABAB antagonistCAS: 117354-64-0Purity: Molecular Weight: 265.71Formula : C9H12ClNO4SPhysical state: Solidsolubility : Soluble in 0.1 M NaOH…

2-Hydroxy Imipramine (CAS 303-70-8)

Product Name : 2-Hydroxy Imipramine (CAS 303-70-8)Synonym : 5--10,11-dihydro-5H-dibenzazepin-2-ol;2-Hydroxyimipramine; G 33679Application : 2-Hydroxy Imipramine is a metabolite of ImipramineCAS: 303-70-8Purity: Molecular Weight: 296.41Formula : C19H24N2OPhysical state: Solidsolubility : Soluble in…

2-Hydroxy-5-methylbenzaldehyde (CAS 613-84-3)

Product Name : 2-Hydroxy-5-methylbenzaldehyde (CAS 613-84-3)Synonym : 2,5-Cresotaldehyde; 5-MethylsalicylaldehydeApplication : CAS: 613-84-3Purity: Molecular Weight: 136.Price of 2-Hydroxy-1-morpholin-4-ylethanone 15Formula : C8H8O2Physical state: Solidsolubility : Soluble in water (8.2611225-93-3 manufacturer 3 mg/ml…

2-Hexanol (CAS 626-93-7)

Product Name : 2-Hexanol (CAS 626-93-7)Synonym : (±)-2-Hexanol; Butyl methyl carbinolApplication : CAS: 626-93-7Purity: Molecular Weight: 102.17Formula : C6H14OPhysical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point:…

2-Furonitrile (CAS 617-90-3)

Product Name : 2-Furonitrile (CAS 617-90-3)Synonym : Application : 2-Furonitrile is employed as substrate to investigate the substrate specificity of nitrilaseCAS: 617-90-3Purity: ≥98%Molecular Weight: 93.3-(4-Bromophenyl)oxetan-3-ol Formula 08Formula : C5H3NOPhysical state:…

2-(furan-3-yl)-1H-1,3-benzodiazol-5-amine dihydrochloride

Product Name : 2-(furan-3-yl)-1H-1,3-benzodiazol-5-amine dihydrochlorideSynonym : Application : CAS: Purity: Molecular Weight: 272.13Formula : C11H11Cl2N3OPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: C1=CC2=C(C=C1N)NC(=N2)C3=COC=C3.Fmoc-Lys(Mtt)-OH uses Cl.Buy1,3,5-Triazine…

2-Fluorophenylacetonitrile (CAS 326-62-5)

Product Name : 2-Fluorophenylacetonitrile (CAS 326-62-5)Synonym : 2-Fluorobenzyl cyanideApplication : CAS: 326-62-5Purity: Molecular Weight: 135.182201-77-0 Purity 14Formula : C8H6FNPhysical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point:…

2-Fluoro-5-(4-methoxyphenyl)pyridine (CAS 444120-93-8)

Product Name : 2-Fluoro-5-(4-methoxyphenyl)pyridine (CAS 444120-93-8)Synonym : Application : CAS: 444120-93-8Purity: Molecular Weight: 203.D-Ala-D-Ala web 21Formula : C12H10FNOPhysical state: solubility : Shipping Condition : Store at 4° CMelting point: SMILES:…

1-(2-hydroxyethyl)-5-propyl-1H-pyrazole-4-carboxylic acid

Product Name : 1-(2-hydroxyethyl)-5-propyl-1H-pyrazole-4-carboxylic acidSynonym : Application : MF: C9H14N2O3, MW: 198.22CAS: Purity: Molecular Weight: 198.22Formula : C9H14N2O3Physical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES:…

2-Fluoro-4-methylbenzaldehyde (CAS 146137-80-6)

Product Name : 2-Fluoro-4-methylbenzaldehyde (CAS 146137-80-6)Synonym : 3-Fluoro-4-formyltoluene; 2-Fluoro-p-tolualdehydeApplication : CAS: 146137-80-6Purity: Molecular Weight: 138.Boc-amido-PEG9-amine supplier 14Formula : C8H7FOPhysical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point:…

[2-Ethylimino-3-(2,4,6-trimethyl-phenyl)-2,3-dihydro-thiazol-4-yl]-acetic acid ethyl ester

Product Name : -acetic acid ethyl esterSynonym : Application : MF: C18H24N2O2S, MW: 332.46CAS: Purity: Molecular Weight: 332.46Formula : C18H24N2O2SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting…

2-ethoxycyclopropane-1-carboxylic acid

Product Name : 2-ethoxycyclopropane-1-carboxylic acidSynonym : Application : CAS: Purity: Molecular Weight: 130.14Formula : C6H10O3Physical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CCOC1CC1C(=O)OReferences: 1505818-73-4 Chemical…

2-Ethoxybenzonitrile (CAS 6609-57-0)

Product Name : 2-Ethoxybenzonitrile (CAS 6609-57-0)Synonym : Application : CAS: 6609-57-0, MF: C9H9NO, MW: 147.17CAS: 6609-57-0Purity: Molecular Weight: 147.BuyDibenzyl carbonate 17Formula : C9H9NOPhysical state: solubility : Shipping Condition : Melting…

2-(Difluoromethoxy)phenyl isocyanate (CAS 186589-03-7)

Product Name : 2-(Difluoromethoxy)phenyl isocyanate (CAS 186589-03-7)Synonym : Application : CAS: 186589-03-7, MF: C8H5F2NO2, MW: 185.13CAS: 186589-03-7Purity: Molecular Weight: 185.13Formula : C8H5F2NO2Physical state: solubility : Shipping Condition : Store at…

2-Dicyclohexylphosphino-2′-(N,N-dimethylamino)biphenyl (CAS 213697-53-1)

Product Name : 2-Dicyclohexylphosphino-2′-(N,N-dimethylamino)biphenyl (CAS 213697-53-1)Synonym : Application : CAS: 213697-53-1Purity: Molecular Weight: 393.BuyTris(pyrazol-1-yl)methane 54Formula : C26H36NPPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 121-124° C…

2-Deoxy-D-arabino-hexose Propylene Dithioacetal (CAS 91294-63-2)

Product Name : 2-Deoxy-D-arabino-hexose Propylene Dithioacetal (CAS 91294-63-2)Synonym : Application : CAS: 91294-63-2Purity: Molecular Weight: 254.37Formula : C9H18O4S2Physical state: Solidsolubility : Soluble in DMSO and MethanolShipping Condition : Store at…

2-Cyclohexen-1-ol (CAS 822-67-3)

Product Name : 2-Cyclohexen-1-ol (CAS 822-67-3)Synonym : Cyclohex-2-enolApplication : CAS: 822-67-3, MF: C6H10O, MW: 98.14, Purity: 95%CAS: 822-67-3Purity: 95%Molecular Weight: 98.14Formula : C6H10OPhysical state: Liquidsolubility : Shipping Condition : Store…

2-Cyanoethyl Phosphorodichloridite (CAS 76101-30-9)

Product Name : 2-Cyanoethyl Phosphorodichloridite (CAS 76101-30-9)Synonym : (2-Cyanoethoxy)dichlorophosphine; β-CyanoethylphosphorodichloriditeApplication : 2-Cyanoethyl Phosphorodichloridite is a phosphorylating agentCAS: 76101-30-9Purity: Molecular Weight: 171.1-Boc-4-bromomethylpiperidine custom synthesis 95Formula : C3H4NOPCl2Physical state: Liquidsolubility : Shipping…

1-(2-Ethoxyphenyl)-2-thiourea (CAS 1516-38-7)

Product Name : 1-(2-Ethoxyphenyl)-2-thiourea (CAS 1516-38-7)Synonym : Application : CAS: 1516-38-7Purity: Molecular Weight: 196.27Formula : C9H12N2OSPhysical state: solubility : Shipping Condition : Melting point: SMILES: References: 1228281-54-6 Formula Methyl 3-fluoro-5-iodo-2-methylbenzoate…

2-Chloropyridine-5-acetonitrile (CAS 39891-09-3)

Product Name : 2-Chloropyridine-5-acetonitrile (CAS 39891-09-3)Synonym : Application : CAS: 39891-09-3Purity: Molecular Weight: 152.58Formula : C7H5ClN2Physical state: solubility : Shipping Condition : Melting point: SMILES: References: BuyEthyl 4,4-difluoro-5-hydroxypentanoate 1250731-69-1 custom…

2-(chloromethyl)-7-(trifluoromethyl)quinazolin-4(3H)-one

Product Name : 2-(chloromethyl)-7-(trifluoromethyl)quinazolin-4(3H)-oneSynonym : Application : CAS: Purity: Molecular Weight: 262.62Formula : C10H6ClF3N2OPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 176.Price of 4-Bromoisoxazol-3-amine 74° C…

2-(chloromethyl)-5-(2-chlorophenyl)thieno[2,3-d]pyrimidin-4(3H)-one

Product Name : 2-(chloromethyl)-5-(2-chlorophenyl)thienopyrimidin-4(3H)-oneSynonym : Application : CAS: Purity: Molecular Weight: 311.19Formula : C13H8Cl2N2OSPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: 246.Perfluorohexyloctane manufacturer 80° C (Predicted)SMILES:…

2-Chlorocyclopentanone (CAS 694-28-0)

Product Name : 2-Chlorocyclopentanone (CAS 694-28-0)Synonym : Application : CAS: 694-28-0Purity: Molecular Weight: 118.36902-22-4 Chemscene 56Formula : C5H7ClOPhysical state: solubility : Shipping Condition : Store at 4° CMelting point: SMILES:…

2-chloro-N-quinolin-5-ylpropanamide

Product Name : 2-chloro-N-quinolin-5-ylpropanamideSynonym : Application : CAS: Purity: Molecular Weight: 234.68Formula : C12H11ClN2OPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CC(C(=O)NC1=CC=CC2=C1C=CC=N2)ClReferences: BuyCholic acid Price…

2-chloro-N-cyclopentyl-N-(1,1-dioxidotetrahydrothien-3-yl)acetamide

Product Name : 2-chloro-N-cyclopentyl-N-(1,1-dioxidotetrahydrothien-3-yl)acetamideSynonym : Application : MF: C11H18ClNO3S, MW: 279.N-Fmoc-N-(2-phenylethyl)-glycine Chemscene 78CAS: Purity: Molecular Weight: 279.78Formula : C11H18ClNO3SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point:…

2-Chloro-N-(4-methylthiophenyl)-acetamide (CAS 27978-30-9)

Product Name : 2-Chloro-N-(4-methylthiophenyl)-acetamide (CAS 27978-30-9)Synonym : Application : CAS: 27978-30-9, MF: C9H10ClNOS, MW: 215.Tetrabenzyl pyrophosphate web 7CAS: 27978-30-9Purity: Molecular Weight: 215.7Formula : C9H10ClNOSPhysical state: Solidsolubility : Shipping Condition :…

2-chloro-N-(4-ethyl-2,5-dioxo-4-phenylimidazolidin-1-yl)acetamide

Product Name : 2-chloro-N-(4-ethyl-2,5-dioxo-4-phenylimidazolidin-1-yl)acetamideSynonym : Application : MF: C13H14ClN3O3, MW: 295.72CAS: Purity: Molecular Weight: 295.72Formula : C13H14ClN3O3Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 244.6-Bromo-3-chloro-2-fluorobenzaldehyde Price…

2-chloro-N-[4-chloro-3-(piperidin-1-ylsulfonyl)phenyl]acetamide (CAS 923756-39-2)

Product Name : 2-chloro-N-acetamide (CAS 923756-39-2)Synonym : Application : CAS: 923756-39-2Purity: Molecular Weight: 351.79208-84-7 Chemical name 25Formula : C13H16Cl2N2O3SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point:…

2-chloro-N-(3,5-dicyano-4-methylthien-2-yl)acetamide

Product Name : 2-chloro-N-(3,5-dicyano-4-methylthien-2-yl)acetamideSynonym : Application : CAS: Purity: Molecular Weight: 239.68Formula : C9H6ClN3OSPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 188.BuyMethyl 2-(2-bromothiazol-4-yl)acetate 27° C (Predicted)SMILES:…

2-chloro-N-[2-(phenylthio)ethyl]acetamide

Product Name : 2-chloro-N-acetamideSynonym : Application : MF: C10H12ClNOS, MW: 229.73CAS: Purity: Molecular Weight: 229.73Formula : C10H12ClNOSPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: C1=CC=C(C=C1)SCCNC(=O)CClReferences:…

2-chloro-N-(2-cyanoethyl)-N-(4-fluorophenyl)acetamide

Product Name : 2-chloro-N-(2-cyanoethyl)-N-(4-fluorophenyl)acetamideSynonym : Application : CAS: Purity: Molecular Weight: Formula : Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 85-88° CSMILES: References: Fmoc-Lys(Alloc)-OH supplier…

1,2-Dimyristoyl-sn-glycero-3-phospho-sn-glycerol sodium salt (CAS 116870-30-5)

Product Name : 1,2-Dimyristoyl-sn-glycero-3-phospho-sn-glycerol sodium salt (CAS 116870-30-5)Synonym : Application : 1,2-Dimyristoyl-sn-glycero-3-phospho-sn-glycerol sodium salt is a phospholipid also known as DMPGCAS: 116870-30-5Purity: Molecular Weight: 688.85Formula : C34H66NaO10PPhysical state: Solidsolubility :…

2-chloro-N-2-[(morpholin-4-ylsulfonyl)methyl]benzylacetamide

Product Name : 2-chloro-N-2-benzylacetamideSynonym : Application : MF: C14H19ClN2O4S, MW: 346.83CAS: Purity: Molecular Weight: 346.83Formula : C14H19ClN2O4SPhysical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: C1COCCN1S(=O)(=O)CC2=CC=CC=C2CNC(=O)CClReferences:…

1,2-Dimethylhydrazine dihydrochloride (CAS 306-37-6)

Product Name : 1,2-Dimethylhydrazine dihydrochloride (CAS 306-37-6)Synonym : Application : CAS: 306-37-6Purity: Molecular Weight: 133.1018295-42-5 Data Sheet 02Formula : C2H8N2.BuySilver acetate 2HClPhysical state: Solidsolubility : Soluble in water, and ethanol.PMID:33534892…

2-chloro-9,10-dihydroacridine

Product Name : 2-chloro-9,10-dihydroacridineSynonym : Application : MW: 215.68CAS: Purity: Molecular Weight: Formula : Physical state: solubility : Shipping Condition : Melting point: SMILES: c1ccc2c(c1)Cc3cc(ccc3N2)ClReferences: 2 Formula NH2-PEG2-C6-Cl custom synthesis…

2-Chloro-6-fluorobenzyl bromide (CAS 68220-26-8)

Product Name : 2-Chloro-6-fluorobenzyl bromide (CAS 68220-26-8)Synonym : Application : CAS: 68220-26-8, MF: C7H5BrClF, MW: 223.47, Purity: ≥97%CAS: 68220-26-8Purity: ≥97%Molecular Weight: 223.47Formula : C7H5BrClFPhysical state: Liquidsolubility : Shipping Condition :…

2-chloro-5-[(2-chloro-4-fluorophenyl)amino]sulfonylbenzoic acid

Product Name : 2-chloro-5-sulfonylbenzoic acidSynonym : Application : MF: C13H8Cl2FNO4S, MW: 364.18CAS: Purity: Molecular Weight: 364.18Formula : C13H8Cl2FNO4SPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: 208.1-Bromobutan-2-one…

2-Chloro-4-(trifluoromethyl)benzenesulfonyl chloride (CAS 175205-54-6)

Product Name : 2-Chloro-4-(trifluoromethyl)benzenesulfonyl chloride (CAS 175205-54-6)Synonym : Application : CAS: 175205-54-6Purity: Molecular Weight: 279.06Formula : C7H3Cl2F3O2SPhysical state: solubility : Shipping Condition : Melting point: SMILES: C1=CC(=C(C=C1C(F)(F)F)Cl)S(=O)(=O)ClReferences: 2-Chloro-5,7-difluorobenzothiazole web 1196154-13-8…

2-Chloro-4,5-difluoro-benzoyl chloride (CAS 121872-95-5)

Product Name : 2-Chloro-4,5-difluoro-benzoyl chloride (CAS 121872-95-5)Synonym : Application : CAS: 121872-95-5Purity: Molecular Weight: 210.1361220-22-5 Price 99Formula : C7H2Cl2F2OPhysical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point:…

2-Chloro-3-pyridineboronic acid pinacol ester (CAS 452972-11-1)

Product Name : 2-Chloro-3-pyridineboronic acid pinacol ester (CAS 452972-11-1)Synonym : Application : CAS: 452972-11-1, MF: C11H15BClNO2, MW: 239.51CAS: 452972-11-1Purity: Molecular Weight: 239.51Formula : C11H15BClNO2Physical state: Solidsolubility : Shipping Condition :…

2-Chloro-2′-deoxyadenosine (CAS 4291-63-8)

Product Name : 2-Chloro-2′-deoxyadenosine (CAS 4291-63-8)Synonym : Cladribine; 2CdAApplication : 2-Chloro-2′-deoxyadenosine is an apoptosis inducerCAS: 4291-63-8Purity: ≥99%Molecular Weight: 285.7Formula : C10H12ClN5O3Physical state: Solidsolubility : Soluble in DMSO ( ≥57 mg/ml),…

1-[(3,4-difluorophenyl)methyl]piperidin-4-amine

Product Name : 1-piperidin-4-amineSynonym : Application : CAS: Purity: Molecular Weight: 226.27Formula : C12H16F2N2Physical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: C1CN(CCC1N)CC2=CC(=C(C=C2)F)FReferences: Buy5-Bromo-2-chlorothiazolopyridine 3-(Hydroxymethyl)piperidin-2-one Chemscene…

2-Butyl-5-chloro-1H-imidazole (CAS 158365-99-2)

Product Name : 2-Butyl-5-chloro-1H-imidazole (CAS 158365-99-2)Synonym : Application : CAS: 158365-99-2Purity: Molecular Weight: 158.Buy105751-18-6 63Formula : C7H11ClN2Physical state: Solidsolubility : Soluble in Chloroform and MethanolShipping Condition : Store at 4°…

2-Bromothiophene (CAS 1003-09-4)

Product Name : 2-Bromothiophene (CAS 1003-09-4)Synonym : Application : 2-Bromothiophene is a sulfur compound which undergoes metalation-alkylation reaction with various electrophiles to form various 5-alkylated 2-bromo productsCAS: 1003-09-4Purity: 98%Molecular Weight:…

2-(bromomethyl)-4-fluoro-1-nitrobenzene

Product Name : 2-(bromomethyl)-4-fluoro-1-nitrobenzeneSynonym : Application : CAS: Purity: Molecular Weight: 234.02Formula : C7H5BrFNO2Physical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: C1=CC(=C(C=C1F)CBr)(=O)References: Hex-5-yn-1-ol structure 1936077-76-7…

2-Bromomethyl-4-chlorophenylboronic acid, pinacol ester (CAS 957034-64-9)

Product Name : 2-Bromomethyl-4-chlorophenylboronic acid, pinacol ester (CAS 957034-64-9)Synonym : Application : CAS: 957034-64-9Purity: Molecular Weight: 331.4Formula : C13H17BBrClO2Physical state: solubility : Shipping Condition : Melting point: SMILES: B1(OC(C(O1)(C)C)(C)C)C2=C(C=C(C=C2)Cl)CBrReferences: (E)-4,8-Dimethylnona-1,3,7-triene…

2-Bromoethyl acetate (CAS 927-68-4)

Product Name : 2-Bromoethyl acetate (CAS 927-68-4)Synonym : Bromoethyl acetate; 2-BromoethylacetateApplication : CAS: 927-68-4Purity: 95%Molecular Weight: 167.00Formula : C4H7BrO2Physical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point:…

2-Bromobenzo[d]thiazole-5-carbonitrile (CAS 864265-83-8)

Product Name : 2-Bromobenzothiazole-5-carbonitrile (CAS 864265-83-8)Synonym : Application : CAS: 864265-83-8Purity: Molecular Weight: 239.856412-22-1 Data Sheet 09Formula : C8H3BrN2SPhysical state: solubility : Shipping Condition : Melting point: SMILES: C1=CC2=C(C=C1C#N)N=C(S2)BrReferences: 150529-93-4…

2-Bromo-5-trifluoromethylthiophene (CAS 143469-22-1)

Product Name : 2-Bromo-5-trifluoromethylthiophene (CAS 143469-22-1)Synonym : Application : CAS: 143469-22-1Purity: Molecular Weight: 231.03Formula : C5H2BrF3SPhysical state: Liquidsolubility : Shipping Condition : Melting point: SMILES: References: 3-Chloro-5-nitro-1H-pyrazole uses 3-Amino-4-pyridinecarboxaldehyde site…

2-Bromo-1,3-dimethoxybenzene (CAS 16932-45-9)

Product Name : 2-Bromo-1,3-dimethoxybenzene (CAS 16932-45-9)Synonym : Application : CAS: 16932-45-9, MF: C8H9BrO2, MW: 217.06, Purity: ≥95%CAS: 16932-45-9Purity: ≥95%Molecular Weight: 217.1,2,3-Triaminoguanidine;hydrochloride Price 06Formula : C8H9BrO2Physical state: Solidsolubility : Soluble in…

2-Bromo-3-hexylthiophene (CAS 69249-61-2)

Product Name : 2-Bromo-3-hexylthiophene (CAS 69249-61-2)Synonym : Application : CAS: 69249-61-2Purity: Molecular Weight: 247.20Formula : C10H15BrSPhysical state: Liquidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CCCCCCC1=C(SC=C1)BrReferences: 288617-75-4…

2-Bromo-1-fluoro-4-iodobenzene (CAS 811842-30-5)

Product Name : 2-Bromo-1-fluoro-4-iodobenzene (CAS 811842-30-5)Synonym : 3-Bromo-4-fluoroiodobenzeneApplication : CAS: 811842-30-5Purity: Molecular Weight: 300.89Formula : C6H3BrFIPhysical state: Liquidsolubility : Shipping Condition : Store at 4° CMelting point: SMILES: C1=CC(=C(C=C1I)Br)FReferences: BuyBODIPY-FL…

2-bromo-1-[4-(difluoromethoxy)-3-methoxyphenyl]ethanone

Product Name : 2-bromo-1-ethanoneSynonym : Application : CAS: Purity: Molecular Weight: 295.Mal-amido-PEG8-NHS ester custom synthesis 08Formula : C10H9BrF2O3Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 84.2152673-80-6…

(2-Biphenylylmethyl)zinc bromide solution (CAS 312624-17-2)

Product Name : (2-Biphenylylmethyl)zinc bromide solution (CAS 312624-17-2)Synonym : Application : CAS: 312624-17-2, MF: C13H11BrZn, MW: 312.52CAS: 312624-17-2Purity: Molecular Weight: 312.Buy6-Chlorobenzophenazin-5-ol 52Formula : C13H11BrZnPhysical state: solubility : Shipping Condition :…

2-Benzylimidazo[1,5-a]quinolinium chloride (CAS 849797-78-0)

Product Name : 2-Benzylimidazoquinolinium chloride (CAS 849797-78-0)Synonym : Application : CAS: 849797-78-0, MF: C18H15ClN2, MW: 294.78CAS: 849797-78-0Purity: Molecular Weight: 294.78Formula : C18H15ClN2Physical state: Solidsolubility : Shipping Condition : Melting point:…

2-(benzoylamino)-6,6-difluoro-5-hydroxyhexanoic acid

Product Name : 2-(benzoylamino)-6,6-difluoro-5-hydroxyhexanoic acidSynonym : Application : MF: C13H15F2NO4, MW: 287.26CAS: Purity: Molecular Weight: 287.Price of 335599-07-0 26Formula : C13H15F2NO4Physical state: solubility : Shipping Condition : Melting point: SMILES:…

2-azabicyclo[2.1.1]hexane-1-carboxylic acid hydrochloride

Product Name : 2-azabicyclohexane-1-carboxylic acid hydrochlorideSynonym : Application : MW: 163.6CAS: Purity: Molecular Weight: Formula : Physical state: Solidsolubility : Shipping Condition : Melting point: SMILES: References: 1239319-91-5 web Formula…

2-Aminoethyl hydrogen sulfate (CAS 926-39-6)

Product Name : 2-Aminoethyl hydrogen sulfate (CAS 926-39-6)Synonym : Sulfuric acid mono 2-aminoethylesterApplication : 2-Aminoethyl hydrogen sulfate is a product for proteomics researchCAS: 926-39-6Purity: ≥98%Molecular Weight: 141.1020665-73-9 Purity 15Formula :…

2-amino-N-(2-ethoxyphenyl)benzamide

Product Name : 2-amino-N-(2-ethoxyphenyl)benzamideSynonym : Application : MW: 256.3CAS: Purity: Molecular Weight: Formula : Physical state: solubility : Shipping Condition : Melting point: 192.149353-72-0 Chemical name 19° C (Predicted)SMILES: References:…

2-amino-N-(3-chloro-2-methylphenyl)acetamide hydrochloride

Product Name : 2-amino-N-(3-chloro-2-methylphenyl)acetamide hydrochlorideSynonym : Application : MW: 235.11CAS: Purity: Molecular Weight: Formula : Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: SMILES: References: 2-(4-Nitrophenyl)-2-oxoacetic…

(2-amino-6-tert-butyl-4,5,6,7-tetrahydro-1-benzothien-3-yl)(3-fluorophenyl)methanone

Product Name : (2-amino-6-tert-butyl-4,5,6,7-tetrahydro-1-benzothien-3-yl)(3-fluorophenyl)methanoneSynonym : Application : CAS: Purity: Molecular Weight: 331.45Formula : C19H22FNOSPhysical state: solubility : Shipping Condition : Store at room temperatureMelting point: SMILES: CC(C)(C)C1CCC2=C(C1)SC(=C2C(=O)C3=CC(=CC=C3)F)NReferences: 2,3-Dihydroxyterephthalic acid structure…

2-Amino-5-pyrimidinol (CAS 143489-45-6)

Product Name : 2-Amino-5-pyrimidinol (CAS 143489-45-6)Synonym : Application : CAS: 143489-45-6Purity: Molecular Weight: 111.3-Amino-6-chloropyridine-2-carboxamide Chemscene 10Formula : C4H5N3OPhysical state: Solidsolubility : Soluble in DMSOShipping Condition : Store at 4° CMelting…

2-Amino-5-nitrobenzanilide (CAS 30481-54-0)

Product Name : 2-Amino-5-nitrobenzanilide (CAS 30481-54-0)Synonym : Application : CAS: 30481-54-0Purity: Molecular Weight: 257.24Formula : C13H11N3O3Physical state: solubility : Shipping Condition : Melting point: SMILES: References: 156311-83-0 Data Sheet Price…

2-Amino-5-chloropyridine (CAS 1072-98-6)

Product Name : 2-Amino-5-chloropyridine (CAS 1072-98-6)Synonym : Application : CAS: 1072-98-6Purity: Molecular Weight: 128.56Formula : C5H5ClN2Physical state: Solidsolubility : Shipping Condition : Store at room temperatureMelting point: 135-138° C (lit.+(ClO4)-…

2-Amino-4-methoxycarbonylphenylboronic acid, pinacol ester, HCl (CAS 850567-49-6)

Product Name : 2-Amino-4-methoxycarbonylphenylboronic acid, pinacol ester, HCl (CAS 850567-49-6)Synonym : Methyl 3-amino-4-boronobenzoate, pinacol ester, HClApplication : CAS: 850567-49-6Purity: Molecular Weight: 313.6Formula : C14H20BNO4•HClPhysical state: Solidsolubility : Shipping Condition :…

Y B Lymphocytes and Infection with EBV. Peripheral blood B cells

Y B Lymphocytes and Infection with EBV. Peripheral blood B cells were isolated by unfavorable choice and infections with EBV were performed as described (19). Culture Circumstances. Newly infected B…

Orting (BD FACSAria II, San Jose, CA, USA). The percentages of

Orting (BD FACSAria II, San Jose, CA, USA). The percentages of MM cells in mononuclear samples have been B50 . Isolated MM cells have been cultured in Iscove’s modified Dulbeco’s…

D files were collected on either the Cardiax or CorScience ADC

D files had been collected on either the Cardiax or CorScience ADC (i.e., the ultimate interpretive results from the Leuven plan had been the exact same under each from the…

And apoptotic cell deaths have long been viewed as because the primary

And apoptotic cell deaths have lengthy been thought of because the main pathological events in ischemic stroke,50,51 autophagy has been recently recognized as a possible deleterious occasion also. Activation of…

On state. Allosterism relies on the efficiency of transmission of energy

On state. Allosterism relies around the efficiency of transmission of energy from the remote site for the catalytic web site. This energetic coupling inherently depends on the structure of the…

Lecularneurodegeneration.com/content/8/1/Page eight ofthe context and tone conditioned worry memory

Lecularneurodegeneration.com/content/8/1/Page eight ofthe context and tone conditioned worry memory paradigm , utilised with younger cohorts of BRI2A mice. Overall, our outcomes suggest that chronic exposure to aggregated extracellular A is…

1.orgincluding ABA, external calcium, darkness, and H2O2 [3]. In yeasts

1.orgincluding ABA, external calcium, darkness, and H2O2 . In yeasts, the mitogenactivated protein kinases (MAPKs) have already been shown to become inactivated by protein tyrosine phosphatases (PTPs) . The S.…

Omain and an active kinase (17, 21), is suppressed by a null allele

Omain and an active kinase (17, 21), is suppressed by a null allele of a pectin methyl esterase, pme3. Mutations within the WAK2cTAP extracellular domain that remove pectin binding also…

G TS in epidemiologic studies. Modification of questions to correspond to

G TS in epidemiologic studies. Modification of queries to correspond towards the DSMV may possibly cut down the complexity in establishing criterion B, but broader alterations towards the administration format…

QSPR models of a particular sort and percentages of QSPR models

QSPR models of a particular form and percentages of QSPR models whose R2 values are in a certain intervalQSPR model Typical R2 Interval of R2 R2 0.9 0.9 R2 QSPR…

Ry cytokines implicated in human IPAH [34] and in the MCTinduced PH

Ry cytokines implicated in human IPAH and within the MCTinduced PH model exactly where its inhibition ameliorates PH both preventatively and therapeutically . Secondly, involvement of Ang II via its…

Oup (qC1 ). These descriptors were utilized to establish the QSPR models

Oup (qC1 ). These descriptors have been utilized to establish the QSPR models by the common equation: pKa = pH qH pO qO pC1 qC1 p (two)exactly where pH ,…

Ividuals with ASD indicate that it truly is a minority (approximately 200 ) of

Ividuals with ASD indicate that it is a minority (about 200 ) of individuals that exhibit ASD and epilepsy cooccurrence, and the underlying biological etiologies in these individuals are unknown…

Quipment and personnel, and is not readily out there at quite a few centers.

Quipment and personnel, and is not readily obtainable at several centers. Despite the fact that newer point of care methodologies have shown clinical promise with regard to quantification of platelet…

12 and IFN and parasiteburdens in BALB/c mice infected with Leishmania

12 and IFN and parasiteburdens in BALB/c mice infected with Leishmania donovani and treated with recombinant IL33 (rIL33) or not treated (NT). mRNA induction of IL12 (A) and IFN (B)…

Bl/6 mice within the presence of recombinant human colonystimulating element 1 (1 104 units

Bl/6 mice in the presence of recombinant human colonystimulating factor 1 (1 104 units/ml, a gift from Chiron) for 6 days. On day 6, BMMs had been harvested and plated…

Stablished for S = two mononuclear oxoiron(IV) complexes.648 In the pathway of

Stablished for S = two mononuclear oxoiron(IV) complexes.648 In the pathway of C bond activation by a highspin FeIV=O center, 1 electron in the substrate that has the same spin…

I at position two (2Oacetylation) confers serotypes 1b, 3a, 3b, 4b, and

I at position two (2Oacetylation) confers serotypes 1b, 3a, 3b, 4b, and 7b with group issue six (six, 18, 19). Glucosylation is mediated by three genes (gtrA, gtrB, and gtr…

Lementary material. Each an ambient and a shipnoise recording had been created

Lementary material. Each an ambient along with a shipnoise recording have been produced at every single of 3 UK ports, and playback tracks constructed in AUDACITY v. 1.3.13 (http://audacity.sourceforge.net/). Experimental…

Lobin A1c, FPG: Fasting plasma glucoseHbA1c: Glycated haemoglobin A

Lobin A1c, FPG: Fasting plasma glucoseHbA1c: Glycated haemoglobin A1c, FPG: Fasting plasma glucoseSIndian Journal of Endocrinology and Metabolism / 2013 / Vol 17 / SupplementSaboo and Patel: A1chieve study expertise…

Dox homeostasis may be an important regulator of angiogenesis (18), the function

Dox homeostasis might be a crucial regulator of angiogenesis (18), the function of TXNIP in mediating VEGF angiogenic signal is just not totally understood. The present study documents the first…

Passos Cristiano et al. / Comparative Cytogenetics eight(three): 22331 (2014)Figure 1. Mitotic karyotypes of Melitoma

Passos Cristiano et al. / Comparative Cytogenetics 8(three): 22331 (2014)Figure 1. Mitotic karyotypes of Melitoma segmentaria. a Giemsa staining (female) b Cbanding (male). Bar=5m.tern and the nomenclature proposed by Imai…

Anc28 and PaCa2 cells have been maintained in Dulbecco’s Modified Eagle

Anc28 and PaCa2 cells were maintained in Dulbecco’s Modified Eagle’s Medium (Cellgro, NJ) (DMEM) containing 10 calf serum (Life Technologies Inc., Gaithersburg MD.), 50 units/ml penicillin, and 50ug/ml streptomycin at…

Such a robust nonspecific response that macrophage activation might flood out

Such a powerful nonspecific response that macrophage activation may flood out any selective neuroprotective response. Also, although we applied GMCSF to recruit and boost extrinsic macrophage activity, the major impact…

N EB EB AA DA DANote. I, intrusions; A, avoidance; NACM

N EB EB AA DA DANote. I, intrusions; A, avoidance; NACM, negative alterations in cognition and mood; AAR, alterations in arousal and reactivity; D, dysphoria; DA, dysphoric arousal; AA, anxious…

five.6] three.1 [2.3.7] Extensor ( J) 3.9 [2.5] 2.6 [1.9.5] Trunk flexor and extensor strength (isokinetic dynamometer) (increase=better

5.6] three.1 Extensor ( J) 3.9 two.six Trunk flexor and extensor strength (isokinetic dynamometer) (increase=better) Flexor ( J) 25 31 Extensor ( J) 25 151] 33 0.84 0.81 112 10…

Gulation of Dsh activation, and hence a rise in all 3

Gulation of Dsh activation, and therefore an increase in all 3 Wnt pathways. The three pathways would be the canonical Wnt/betacatenin pathway, the noncanonical planar cell polarity (PCP) pathway, plus…

Tandards are indicated. Total cell lysates from CD14 monocytes (B) and

Tandards are indicated. Total cell lysates from CD14 monocytes (B) and mockinfected (M) or TB40/Einfected (V) MRC5 fibroblasts (C) had been subjected to SDSPAGE and immunoblot analysis. (D) CD14 monocytes…

Support inside every major clade and higher similarity in between EUplFL1 and

Help inside every single important clade and high similarity amongst EUplFL1 and EUplFL2 recommend that an alternative topology to Figure 3 tree could be feasible, in which two independent duplications…

Sigma (s) subunits in the RNA polymerase. Synechocystis sp. PCC 6803 (hereafter

Sigma (s) subunits from the RNA polymerase. Synechocystis sp. PCC 6803 (hereafter Synechocystis) encodes nine various s subunits . Replacement of 1 s subunit within the RNA polymerase with a…

. These modifications are generally found with each other but can exist separately on

. These modifications are usually discovered collectively but can exist separately on their own (Chen et al., 2011b; Yarian et al., 2002) (Figure 1A). Though these conserved modifications have been…

, mechanistic parallels may exist in between the pathogenesis of aortic stenosis and

, mechanistic parallels could exist in between the pathogenesis of aortic stenosis and that of vascular atherosclerosis. The role of hypercholesterolemia in the pathogenesis of atherosclerosis is well known. Provided…

Orldwide for sewage remedy are in India. The fundamental method towards

Orldwide for sewage therapy are in India. The basic method towards collection of technology for sewage remedy is low capital charges, low energy requirements, low operation and maintenance (O M)…

Der a confocal microscope (Nikon) with Metamorph software program employing 206and 1006objectives

Der a confocal microscope (Nikon) with Metamorph software applying 206and 1006objectives, respectively. Nuclei of cells have been stained with DAPI. DAPI is excited at 345 nm and emits at 458…

Mph of overwintering insects [54], such as codling moth larvae [55], might additional contribute

Mph of overwintering insects , such as codling moth larvae , may well additional contribute to the reduce of SCP by noncovalently binding water in their hydration shells, therefore diminishing…

AG and latrunculin B were added for the presynaptic patch pipette

AG and latrunculin B had been added to the presynaptic patch pipette (OAG LatB; blue). (C) Summary of ratios (2nd over 1st) of presynaptic Ca2 current amplitude (C1), FRP size…

Ulation inside the very active antiretroviral therapy era. Methods: The present

Ulation in the extremely active antiretroviral therapy era. Techniques: The present retrospective study was according to 343 HIV sufferers diagnosed from 2005 to 2010 from two clinics in Saskatoon, Saskatchewan.…

Ctivation of Cdk1 by increasing levels with the G1specific cyclin

Ctivation of Cdk1 by increasing levels in the G1specific cyclin Cln3 (the mammalian analog is cyclin D1) triggers phosphorylation and inactivation of your transcriptional repressor Whi5 (the mammalian analog is…

Tibody manage and five input is shown for respective proteins. The amounts

Tibody manage and 5 input is shown for respective proteins. The amounts of pulleddown Drp1 are shown under the respective blots, normalized towards the respective protein. Data are expressed as…

Protein cholesterol, TG: Triglycerides, SBP: Systolic blood stress, VAS: Visual analogue

Protein cholesterol, TG: Triglycerides, SBP: Systolic blood stress, VAS: Visual analogue scaleIndian Journal of Endocrinology and Metabolism / 2013 / Vol 17 / SupplementSSanyal, et al.: A1chieve study experience from…

S [42]. The absence of correlation in between haemoglobin at diagnosis and initial

S . The absence of correlation in between haemoglobin at diagnosis and initial parasitaemia is in line with other studies . In 2007, French experts’ consensus recommended each AP and…

Are plated at a density of 16105 and quantified at daily intervals.

Are plated at a density of 16105 and quantified at everyday intervals. (E) Statistical analyses (n 3 independent samples per experiment) show that the numbers of cells per unit region…

Uration pulse photos and values of many Chl fluorescence parameters have been

Uration pulse pictures and values of many Chl fluorescence parameters were captured. Actual ( PSII ) PSII efficiency, photochemical (qP) and nonphotochemical quenching (NPQ) had been calculated as (FM FS…

Pressed as mean 2AG concentration group). 2AG, 2arachidonyl glycerol; LPS, lipopolysaccharide.

Pressed as imply 2AG concentration group). 2AG, 2arachidonyl glycerol; LPS, lipopolysaccharide.SEM in nmol g1 tissue. (n = 71 perand TNFa levels, effects partially attenuated by CB1 receptor antagonism. With each…

R probable functional roles in heat tension response. These benefits suggest

R probable functional roles in heat tension response. These outcomes suggest that OsNox6 and OsNox7 have various functional mechanisms for pressure responses, though they’re really close in evolution. The different…

Arated having a gradient at 1 ml min1: 010 min 70:30 Solvent A:Solvent

Arated using a gradient at 1 ml min1: 010 min 70:30 Solvent A:Solvent B, 100 min gradient to 100 Solvent B, 208 min one hundred Solvent B, 2830 min gradient…

Ell line discovered to become BRMpositive. As BAF155 is sensitive to

Ell line found to become BRMpositive. As BAF155 is sensitive to degradation, the presence of BAF155 expression in all cell lines such as the constructive manage, H460, demonstrates that degradation…

Sely, experiments investigating intracellular bacterial survival kinetics, also as these

Sely, experiments investigating intracellular bacterial survival kinetics, as well as those investigating osteoblast mortality utilizing two representative isolates of ST80IV (HT20020209) and ST8EMRSA2IV (HT20040117), were conducted applying 3 consecutive passages…

Ipt; offered in PMC 2014 June 01.Chlebowski et al.PageStudy strengths consist of

Ipt; offered in PMC 2014 June 01.Chlebowski et al.PageStudy strengths contain the size of your significant properly characterized, ethnically diverse study population, serial joint symptom determination within the context of…

S combined around the recovery of spermatogenesis following radiation. Preirradiation testicular

S combined around the recovery of spermatogenesis right after radiation. Preirradiation testicular biopsies from both testes, amounting to five from the testis and an typical of 2.two g tissue, were…

NOVA and Tukey’s post hoc test.considerably increased than that

NOVA and Tukey’s post hoc test.considerably elevated than that in CONT and R1 groups ( 0.05). The weights of cecal tissue and content material in FOS and GM groups were…

D slippage inside repetitive DNA sequence components modifications the size of

D slippage within repetitive DNA sequence components modifications the size on the mononucleotide or dinucleotide repeats (microsatellites) which can be scattered all through the genome. Mismatchrepair deficiency may also be…

Entative experiment out of two is shown. Complete L. monocytogenes are

Entative experiment out of two is shown. Entire L. monocytogenes are labeled green with FITC and RNA is visible as red fluorescence (Alexa594), nuclei are stained by DAPI (blue). doi:10.1371/journal.pone.0062872.gpathway…

Ring the transcription rate per gene and altering the fraction of

Ring the transcription price per gene and changing the fraction of 200 rRNA genes that happen to be within the active state. Almost 50 of rDNA repeats are present as…

five. The WHO score is as follows: grade 0 = regular, no mucositis; grade

5. The WHO score is as follows: grade 0 = regular, no mucositis; grade 1 = soreness and erythema; grade2 = erythema, ulceration, can consume solids; grade three = ulcers…

S have been harvested 48 h just after transfection to analyze BRUCE expression. Western

S were harvested 48 h following transfection to analyze BRUCE expression. Western blotting. To detect the BRUCE protein, the cell lysate in radioimmunoprecipitation assay (RIPA) buffer (50 g) was mixed…

Cular orbitals (MOs) for -P-SCl result from electrophilic addition of Cl

Cular orbitals (MOs) for -P-SCl result from electrophilic addition of Cl atom to the sulfur in DMP calculated applying the B3LYP/6-31G* technique are shown in Figure six. From Figure six,…

Es (Falcon, Becton Dickinson, Heidelberg, Germany) at 2?06 cells per dish. The

Es (Falcon, Becton Dickinson, Heidelberg, Germany) at 2?06 cells per dish. The cells have been cultured in RPMI1640 total medium (Gibco-BRL, Regenstein, Germany) like penicillin (100 U/ml, Sigma, St. Louis,…

Ation assay. H9 cells had been infected having a Zap-70 vaccinia virus

Ation assay. H9 cells were infected with a Zap-70 vaccinia virus either alone or with each other using the Nef-Flag virus, followed by treatment with 10 M DQBS for 4…

Nal quality control exactly where all the following parameters were upheld

Nal excellent control exactly where all of the following parameters were upheld: clear definition of objectives, procedures, standards and criteria for the tolerance limits, corrective actions and registration of your…

Ients. In contrast, their frequencies in strains isolated from ART-treated patients

Ients. In contrast, their frequencies in strains isolated from ART-treated patients were substantially improved, suggesting their precise association with ART remedy. Since the ART regimen of those individuals contained two…

Aki et al., 1999) and improves microvascular autoregulation in chronic kidney disease

Aki et al., 1999) and improves microvascular autoregulation in chronic kidney disease (Lin et al., 1998). Additional research are going to be required to ascertain irrespective of whether IGF-1 remedy…

Ees with studies by Wooley et al, who reported the hydrolysis

Ees with studies by Wooley et al, who reported the hydrolysis of micelle cores by proteinase K in crosslinked micelles. To attain a solid formulation of dC3 micelles, we investigated…

Ing the epithelial cycle of spermatogenesis. By way of example, at stage VIII

Ing the epithelial cycle of spermatogenesis. As an example, at stage VIII on the epithelial cycle, remodeling with the BTB is necessary to accommodate the transport of preleptotene spermatocytes which…

Ne checkpoint | Zhu et al.Figure three. Expression of a putative ligand

Ne checkpoint | Zhu et al.Figure 3. Expression of a putative ligand for CD112R. (A) Immune cells in human blood and monocyte-derived DCs have been stained with manage (FLAG-Fc; red)…

OL.(ii) SF-Quality of life outcomes have been also assessed in patients

OL.(ii) SF-Quality of life outcomes have been also assessed in patients switched to lurasidone working with the SF-12 survey, a multipurpose generic measure of overall health status . The SF-12…

B, Angermeyer MC, Leese M, Thornicroft G, Schene A, Kikkert M

B, Angermeyer MC, Leese M, Thornicroft G, Schene A, Kikkert M, Burti L, Tansella M, Becker T: Course of adherence to medication and high-quality of life in individuals with schizophrenia.…

Possesses variety II cells, or sustentacular cells and it has been

Possesses form II cells, or sustentacular cells and it has been proposed that they are adult neural stem cells sustaining neurogenesis in vivo in response to physiological stimuli, like chronic…

A significantly higher incidence of endometrial and ovarian cancer in individuals

A substantially larger incidence of endometrial and ovarian cancer in patients treated with adjuvant hormonal therapy (five.two ) in comparison with individuals not administered hormonal therapy (1.8 , P= 0.002).…

Et al., 2001; Rodriguez-Del Rio et al., 2011) and detailed in Supporting Info.

Et al., 2001; Rodriguez-Del Rio et al., 2011) and detailed in Supporting Info. Endosomal fractions were made use of as manage vesicles to standardize basal levels for protein composition analysis…

Useful commentsand discussions; A. Lenuweit, S. Opitz, H. Wickborn for exceptional

Beneficial commentsand discussions; A. Lenuweit, S. Opitz, H. Wickborn for great technical assistance. J.K., R.F. and M.H. created experiments. J.K., R.F. and M.H. performed experiments and analysed data. J.K., R.F.,…

Dent Hif2 transactivation of gene expression has not been reported in

Dent Hif2 transactivation of gene expression has not been reported in the scientific literature (to our know-how), suggesting that that is a novel regulatory mechanism. Hif2 is preferentially stabilized in…

Oduct of 461 base pairs (bp) encompassing exon 13 of KCNQ3 was amplified

Oduct of 461 base pairs (bp) encompassing exon 13 of KCNQ3 was amplified working with primers KCNQ3_13a: TATTCCAAACCCTTATCTCAT and KCNQ3_13b: AAACAGGTGGGG CTATTA. PCR fragments amplified from the WT allele had…

Evation of cytoplasmic calcium level (Figure 4(d)). The median fluorescence intensity

Evation of cytoplasmic calcium level (Figure four(d)). The median fluorescence intensity of calcium probe escalated within a dose-dependent manner and reached as higher as 3? times more than vehicle handle…

Ut below a protocol approved by the Institutional Animal Care and

Ut below a protocol authorized by the Institutional Animal Care and Use Committee at Baylor College of Medicine and were in accordance using the National Institutes of Health suggestions for…

Far more most likely to have two SLC26A4 mutant alleles than those with

Much more probably to possess 2 SLC26A4 mutant alleles than those with nonsyndromic EVA . In addition, the number of SLC26A4 mutant alleles is substantially correlated using the severity of…

As also demonstrated the antiCaspase-9 and -3 are Crucial to Dasatinib

As also demonstrated the antiCaspase-9 and -3 are Essential to Dasatinib/VPA-induced Apoptosis Pathway in HL60 CellsCaspase-9, an initiator caspase, forms a complex by binding to apoptotic protease-activating factor-1 (Apaf-1), and…

Ally enhanced ERK1/2 phosphorylation and c-Fos expression in LPS-challenged cardiomyocytes, which

Ally improved ERK1/2 phosphorylation and c-Fos expression in LPS-challenged cardiomyocytes, which were prevented by prazosin. These findings recommend that NE enhanced ERK1/2 phosphorylation and c-Fos expression by means of activating…

Ressing osteoclastogenesis. Nat Med. 2009;15(9):1066?071. 13. Karin M, Greten FR. NF-B: linking inflammation

Ressing osteoclastogenesis. Nat Med. 2009;15(9):1066?071. 13. Karin M, Greten FR. NF-B: linking inflammation and immunity to cancer improvement and progression. Nat Rev Immunol. 2005;five(10):749?59. 14. Courtois G, Gilmore TD. Mutations…

Fect of other branched-chain amino acids on AHAS, as Barton and

Fect of other branched-chain amino acids on AHAS, as Barton and Slaughter (1992) and Magee and de Robichon-Szulmajster (1968) observed that leucine also had an inhibiting effect around the AHAS…

p47-phox Recombinant Mouse Monoclonal Antibody [A6B10-R]

Product Name : p47-phox Recombinant Mouse Monoclonal Antibody Predicted band size : 45 kDaObserved band size : 45 kDaSynonyms: 47 kDa autosomal chronic granulomatous disease protein antibody 47 kDa neutrophil…

?.22, p = 0.006). Of these sufferers, 27/40 within the albumin group and 10/16 within the

?.22, p = 0.006). Of these individuals, 27/40 in the albumin group and 10/16 in the saline group had ICP measurements 20 mm Hg (RR 1.08, 95 CI 0.70?.67, p…

Or OTCH2-NICD antibodies. As reported previously (38), below basal situations, RELB

Or OTCH2-NICD antibodies. As reported previously (38), beneath basal circumstances, RELB and p52 were expressed primarily inside the cytoplasm and NICD mainly within the nucleus. Immediately after TNF therapy, colocalization…

B), which suggests that thapsigargin might be utilized as a new

B), which suggests that thapsigargin could be utilised as a brand new NOTCH inhibitor in our model. To investigate whether thapsigargin has a bone-anabolic impact in TNF-Tg mice comparable to…

, Ashland, OR). Confocal microscopy for EBV p52, HHV-6A gp116, HHV-

, Ashland, OR). Confocal microscopy for EBV p52, HHV-6A gp116, HHV-6B gp116, HHV-7 KR4, and the KSHV late gene ORFK8.1. Detection of viral protein expression was performed by immunofluorescence applying…

c-Fos Recombinant Rabbit Monoclonal Antibody [PSH05-77]

Product Name : c-Fos Recombinant Rabbit Monoclonal Antibody Predicted band size : 41 kDaObserved band size : 41-55 kDaSynonyms: Activator protein 1 antibody AP 1 antibody C FOS antibody Cellular…

Ithin the previous 20 years, this very simple view of your lipid droplet

Ithin the past 20 years, this basic view with the lipid droplet (LD) has been refined, and several molecular particulars had been added, as not too long ago reviewed (1?).…

Ifferential effects of cocaine-like and atypical DAT inhibitors is that atypical

Ifferential effects of cocaine-like and atypical DAT inhibitors is the fact that atypical inhibitors engender handful of cocaine-like behavioral responses, not simply because of their special DAT binding profile, but…

ZNF93 Rabbit Polyclonal Antibody

Product Name : ZNF93 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: FLJ12488 HPF34 HTF34 TF34 Zinc finger protein 505 Zinc finger protein 93 (HTF34) Zinc finger…

76) and P. falciparum multidrug-resistant gene (pfmdr1) codon86 mutant allele (Y86) in

76) and P. falciparum multidrug-resistant gene (pfmdr1) codon86 mutant allele (Y86) inside the country . Prevalence of pfcrt T76 mutation has been related to clinical chloroquine resistance and represents a…

ZNF131 Rabbit Polyclonal Antibody

Product Name : ZNF131 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: pHZ 10 pHZ10 Zinc finger protein 131 ZN131_HUMAN ZNF 131 Znf131.Function : May be involved…

Ystem (T3SS), and variety IV pili (9). RsmA negatively controls elements

Ystem (T3SS), and form IV pili (9). RsmA negatively controls variables linked with chronic colonizationpnas.org/cgi/doi/10.1073/pnas.Thomologs (RsmA and RsmE) (13, 14), only RsmA had been identified within the opportunistic human pathogen…

Tion (0.08 Hz). C, nipecotic acid (5 mM) decreased the eEPSC amplitude to

Tion (0.08 Hz). C, nipecotic acid (5 mM) decreased the eEPSC amplitude to about ten of control (n = 9). D, nipecotic acid (five mM) induced a frequency-dependent facilitation through…

VPS72 Rabbit Polyclonal Antibody

Product Name : VPS72 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: CFL1 antibody HGNC11644 antibody Protein YL-1 antibody Swc2 antibody TCFL1 antibody Transcription factor like 1…

Vimentin Mouse Monoclonal Antibody [A6-C1]

Product Name : Vimentin Mouse Monoclonal Antibody Predicted band size : 54 kDaObserved band size : 54 kDaSynonyms: CTRCT30 antibody Epididymis luminal protein 113 antibody FLJ36605 antibody HEL113 antibody VIM…

D on the observations from all treatment options, PSU and consequently negative

D around the observations from all therapies, PSU and consequently damaging PE in our study are most likely attributed for the particularly low sediment organic C (OC) content at all…

Les or oil bodies, serve as a storage compartment for nonpolar

Les or oil bodies, serve as a storage compartment for nonpolar lipids. In S. cerevisiae, triacylglycerols (TG) and steryl esters (SE) will be the two big classes of nonpolar lipids.…

In the amount of LD in dga1 lro1 is markedly reduced

In the amount of LD in dga1 lro1 is markedly reduced than in wild type yeast cells (36).3 Therefore, the low variety of LD within this mutant and its altered…

USP36 Rabbit Polyclonal Antibody

Product Name : USP36 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Deubiquitinating enzyme 1 antibody Deubiquitinating enzyme 36 antibody DUB1 antibody FLJ12851 antibody KIAA1453 antibody Ubiquitin…

Ma Thyroid cancer Melanoma Non-small cell lung cancerTyrosine kinase inhibitors FDA-approved

Ma Thyroid cancer Melanoma Non-small cell lung cancerTyrosine kinase inhibitors FDA-approved Imatinib, 2001 GleevecPhC, cKIT, CDGefitinib, 2003 Erlotinib, 2004 Sorafenib, 2005 Dasatinib, 2006 Sunitinib,Iressa Tarceva Nexavar Sprycel SutentEGFR EGFR VEGFR,…

Ing collect the WAXS information. Raloxifene was kindly provided by Eli

Ing collect the WAXS information. Raloxifene was kindly supplied by Eli Lilly (Indianapolis, IN, USA) below a Material Transfer Agreement to D.B.B. Eli Lilly was not involved within the study…

Quantification prospective of immuno-PET were also assessed [53]. PET quantification of blood-pool

Quantification possible of immuno-PET were also assessed . PET quantification of blood-pool activity within the left ventricle was in fantastic agreement with sampled blood activity, except for heavy weight patients…

Transferrin Rabbit Polyclonal Antibody

Product Name : Transferrin Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Apotransferrin antibody Beta 1 metal binding globulin antibody Beta-1 metal-binding globulin antibody DKFZp781D0156 antibody PRO1400…

Cells and U87-MG human glioblastoma multiforme cells. Even so, the antitumor

Cells and U87-MG human glioblastoma multiforme cells. On the other hand, the antitumor effects of hTERTC27 in hepatoma and its underlying mechanisms are unclear. Inside the existing study, the therapeutic…

Terminal uridylyltransferase 4 Rabbit Polyclonal Antibody

Product Name : Terminal uridylyltransferase 4 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: DKFZp779C1943 antibody EC 2.7.7.52 antibody FLJ42878 antibody KIAA0191 antibody PAP associated domain containing…

.[4] Lung cancer is largely attributable to environmental carcinogens. By far, tobacco

. Lung cancer is largely attributable to environmental carcinogens. By far, tobacco smoke would be the most significant environmental carcinogen leading to lung cancer. These days, the epidemiology of lung…

S–All chemicals had been obtained from Fisher unless noted below. Cloning, Protein

S–All chemicals were obtained from Fisher unless noted below. Cloning, Protein Expression, and Purification–Full-length NWMN2274 was PCR-amplified from S. aureus strain Newman chromosomal DNA with forward primer (5 -AGC GGC…

TREX1 Recombinant Rabbit Monoclonal Antibody [JG35-71]

Product Name : TREX1 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: 3′ 5′ exonuclease TREX1 antibody 3′ repair exonuclease 1 antibody AGS1 antibody AGS5…

T might be observed as being a modified Newton algorithm and that

T can be viewed like a modified Newton algorithm and that equivalent modifications had been applied efficiently elsewhere. On the other hand, it truly is clear from the type of…

TRAM2 Recombinant Rabbit Monoclonal Antibody

Product Name : TRAM2 Recombinant Rabbit Monoclonal AntibodyPredicted band size : 43 kDaObserved band size : 43 kDaSynonyms: Translocating chain-associated membrane protein 2 TRAM2 KIAA0057Function : Translocating chain-associated membrane protein…

TPC2L Rabbit Polyclonal Antibody

Product Name : TPC2L Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Trafficking protein particle complex subunit 2-like proteinTRAPPC2L antibody Trafficking protein particle complex subunit 2-like proteinHSPC126…

N). Once the cutoff criteria set bythis examine have been applied for

N). When the cutoff criteria set bythis review have been applied to the IFN- assay, 79 (30.4 ) of your 260 SIDT-negative cattle from herds with latest BTB outbreaks and…

In liquid smoke couldn’t be eliminated, however, by different fractionation

In liquid smoke couldn’t be eradicated, even so, by distinctive fractionation approaches like filtration, adsorption on charcoal or protein, chloroform extraction (the exercise was retained inside the aqueous fraction), desiccation…

THYN1 Rabbit Polyclonal Antibody

Product Name : THYN1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: HSPC144 antibody MDS012 antibody MGC12187 antibody MY105 antibody THY28 antibody THY28KD antibody thymocyte nuclear protein…

TCP1 alpha/CCTA Recombinant Rabbit Monoclonal Antibody [JE48-48]

Product Name : TCP1 alpha/CCTA Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: AI528772 antibody c-cpn antibody CCT alpha antibody CCT antibody CCT-alpha antibody CCT1…

TBP-1 Rabbit Polyclonal Antibody

Product Name : TBP-1 Rabbit Polyclonal AntibodyPredicted band size : 49 kDaObserved band size : 49 kDaSynonyms: 26S protease regulatory subunit 6A antibody 26S proteasome AAA-ATPase subunit RPT5 antibody Human…

Synaptopodin Rabbit Polyclonal Antibody

Product Name : Synaptopodin Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: KIAA1029 antibody Synaptopodin antibody SYNPO antibody SYNPO_HUMAN antibodyFunction : Antibody Type: Rabbit Polyclonal AntibodyImmunogen :…

Arkers for neurons and astrocytes, respectively. Both CD11b and Iba

Arkers for neurons and astrocytes, respectively. Each CD11b and Iba1 had been utilised as markers for microglia. For immunohistochemistry, mice had been perfused with phosphate-buffered saline, pH 7.5 (PBS) followed…

Which can be developed (by partial fermentation) primarily in southern China. Green

Which can be produced (by partial fermentation) mostly in southern China. Green and black teas are processed differently for the duration of manufacturing. To generate green tea, freshly harvested leaves…

Skp1 Recombinant Rabbit Monoclonal Antibody [JM27-37]

Product Name : Skp1 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: Cyclin A/CDK2 associated p19 antibody Cyclin A/CDK2 associated protein p19 antibody Cyclin-A/CDK2-associated protein…

Smad1 Recombinant Rabbit Monoclonal Antibody [SD2090]

Product Name : Smad1 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: BSP-1 antibody BSP1 antibody HsMAD1 antibody JV4-1 antibody JV41 antibody MAD homolog 1…

Semaphorin 3E Rabbit Polyclonal Antibody

Product Name : Semaphorin 3E Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Coll 5 antibody Coll5 antibody KIAA0331 antibody M sema H antibody M SEMAH antibody…

SV2C Rabbit Polyclonal Antibody

Product Name : SV2C Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Synaptic vesicle protein 2c antibodyFunction : Plays a role in the control of regulated secretion…

SVOP Rabbit Polyclonal Antibody

Product Name : SVOP Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: SVOP antibody Synaptic vesicle 2-related protein antibody SV2-related protein antibodyFunction : Belongs to the major…

STING Recombinant Rabbit Monoclonal Antibody [PSH07-44]

Product Name : STING Recombinant Rabbit Monoclonal Antibody Predicted band size : 42 kDaObserved band size : 37 kDaSynonyms: endoplasmic reticulum IFN stimulator antibody Endoplasmic reticulum interferon stimulator antibody ERIS…

SRF Recombinant Rabbit Monoclonal Antibody [PSH05-06]

Product Name : SRF Recombinant Rabbit Monoclonal Antibody Predicted band size : 52 kDaObserved band size : 67 kDaSynonyms: c fos serum response element binding factor antibody c fos serum…

Ecan, cisplatin, and bevacizumab in individuals with metastatic gastric or gastroesophageal

Ecan, cisplatin, and bevacizumab in patients with metastatic gastric or gastroesophageal junction adenocarcinoma. J Clin Oncol 2006, 24(33):5201?206. 44. Shah MA, Jhawer M, Ilson DH, Lefkowitz RA, Robinson E, Capanu…

SPF45 Rabbit Polyclonal Antibody

Product Name : SPF45 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: 45 kDa-splicing factor antibody RBM 17 antibody Rbm17 antibody RNA binding motif protein 17 antibody…

iFluor™ 488 Conjugated SOX2 Recombinant Rabbit Monoclonal Antibody [PO00-28]

Product Name : iFluor™ 488 Conjugated SOX2 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: ANOP3 antibody cb236 antibody Delta EF2a antibody lcc antibody MCOPS3…

Acid methyl ester displaying M+ ions are shown. m/z 242 represents

Acid methyl ester showing M+ ions are shown. m/z 242 represents monoisotopic mass of myristylmethylester, whereas m/z 256 represents totally labeled species. FA, fatty acid; LPC, lysophosphatidylcholines; PG, phosphatidylglycerols; PS,…

SMG7 Rabbit Polyclonal Antibody

Product Name : SMG7 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: breast cancer-associated antigen SGA-56M antibody C1orf16 antibody EST1 like protein C antibody EST1 telomerase component…

He reports showed that most mutations originate in the parental cell

He reports showed that most mutations originate from the parental cell line (Gore et al., 2011; Cheng et al., 2012; Ruiz et al., 2013). As with the origin of CNVs,…

Is of p53 and its targets PUMA, Bax, and p21 in

Is of p53 and its targets PUMA, Bax, and p21 in fl/fl or / MEFs treated overnight with 20 M etoposide. **P 0.01, n = three, mean ?SEM, Student’s t…

SHP-2 Rabbit Polyclonal Antibody

Product Name : SHP-2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: BPTP3 antibody CFC antibody JMML antibody METCDS antibody MGC14433 antibody NS1 antibody OTTHUMP00000166107 antibody OTTHUMP00000166108…

Antigen stimulation, interacts with Fc RI and is needed for allergic

Antigen stimulation, interacts with Fc RI and is needed for allergic inflammation both in vitro and in vivo (23). Though we reported the function of HDAC3 in allergic skin inflammatory…

Ns of SETBP1 appear to become gain-of-function, are associated with myeloid

Ns of SETBP1 appear to be gain-of-function, are linked with myeloid leukemic transformation and convey a poor prognosis in myelodysplastic syndromes (MDS) and CMML. In the course of the past…

SAP97 Rabbit Polyclonal Antibody

Product Name : SAP97 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Discs large homolog 1 antibody discs large, Drosophila, homolog of, 1 antibody discs, large homolog…

Performed utilizing the Student t-test.Mapk8ip1-silenced stressed cells compared

Performed employing the Student t-test.Mapk8ip1-silenced stressed cells compared together with the adverse handle, whilst Gck, Pdx-1, Insr, Vamp2, Snap25, Syt5, Cacnb, Mafa, and NeuroD remained unaffected (Figure 6A). These findings…

Correspondence needs to be addressed; E-Mail: [email protected]; Tel.: +852-391-

Correspondence ought to be addressed; E-Mail: [email protected]; Tel.: +852-391-792-34; Fax: +852-285-597-30. External Editor: Rudiger Hardeland Received: 15 July 2014; in revised type: 26 September 2014 / Accepted: two October 2014…

Dical oncologists, other internists (OR=1.38; 95 CI, 1.23?1.54) and hospitalists (OR=1.61; 95 CI, 1.32?.96) much more

Dical oncologists, other internists (OR=1.38; 95 CI, 1.23?1.54) and hospitalists (OR=1.61; 95 CI, 1.32?.96) additional normally employed vancomycin.JAMA Intern Med. Author manuscript; available in PMC 2013 June 06.Wright et al.PageDespite…

Rap 2C Rabbit Polyclonal Antibody

Product Name : Rap 2C Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: 2010200P20Rik antibody AI194294 antibody AL022976 antibody BOS_25229 antibody DKFZp313B211 antibody MGC143331 antibody OTTHUMP00000024037 antibody…

0.225 (0.127) for isoleucine, 0.220 (0.137) for phenylanaline, and 0.170 (0.114) for tyrosine.Table four DM-AA score and

0.225 (0.127) for isoleucine, 0.220 (0.137) for phenylanaline, and 0.170 (0.114) for tyrosine.Table 4 DM-AA score and danger of moderate-to-severe atherosclerosis at baseline examination ……………………………………………………………………..DM-AA score as a continuous variable…

GAG content material was lowered with decellularization, specially with trypsin, as well as the

GAG content was decreased with decellularization, in particular with trypsin, and also the GAG content was closest to that in the control with Triton X-100. The preservation of collagen and…

RRAS2 Rabbit Polyclonal Antibody

Product Name : RRAS2 Rabbit Polyclonal AntibodyPredicted band size : 23 kDaObserved band size : 23 kDaSynonyms: C86394 antibody Oncogene RRAS2 antibody Oncogene TC21 antibody Ras like protein TC21 antibody…

Ytes were treated with car, bortezomib, or bortezomib plus Y27632. (B

Ytes have been treated with car, bortezomib, or bortezomib plus Y27632. (B) Western blot for phospho-MLC. (C) Representative confocal photos of human megakaryocytes stained with WGA (red) and phalloidin (green).…

Ding and management with the database. JP had the duty of

Ding and management on the database. JP had the duty of statistical analyses and made suggestions on data presentation. KJP analysed and interpreted the data on inflammatory variables, and MS…

RNF3 Rabbit Polyclonal Antibody

Product Name : RNF3 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: DONG1 antibody PCGF3 antibody PCGF3_HUMAN antibody Polycomb group ring finger 3 antibody Polycomb group RING…

Tress. However, that is relevant due to the fact mild vs. extreme stress could possibly

Tress. Yet, that is relevant for the reason that mild vs. serious pressure may possibly qualitatively alter plant response, either leading to strain priming and adaptation or to hypersensitive response…

T control DNA binding affinity, i.e., the recognition helices and

T control DNA binding affinity, i.e., the recognition helices and -wing, move in a concerted style (Fig. 6a). The allosteric “hot-spot” identified here centered on V66 and L68 then basically…

Unnatural Amino Acid Side Chain on the Conformational Dynamics of Peptides.

Unnatural Amino Acid Side Chain on the Conformational Dynamics of Peptides. Chem.Phys. Chem. 2012; 13:1522?534. (41). Drozdov AN, Grossfield A, Pappu RV. Role of Solvent in Determining Conformational Preferences of…

RBP4 Recombinant Rabbit Monoclonal Antibody [JA33-10]

Product Name : RBP4 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: OTTHUMP00000020114 antibody OTTHUMP00000020115 antibody OTTHUMP00000020116 antibody Plasma retinol binding protein 4 antibody Plasma…

RAB1A Rabbit Polyclonal Antibody

Product Name : RAB1A Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: GTP binding protein RAB 1A antibody mKIAA3012 antibody RAB 1 antibody Rab 1A antibody RAB1…

Phospho-eNOS (S1177) Recombinant Rabbit Monoclonal Antibody [PS01-10]

Product Name : Phospho-eNOS (S1177) Recombinant Rabbit Monoclonal Antibody Predicted band size : 133 kDaObserved band size : 160 kDaSynonyms: cNOS antibody Constitutive NOS antibody EC NOS antibody EC-NOS antibody…

Phospho-DNA PKcs (S2056) Recombinant Rabbit Monoclonal Antibody [JE41-92]

Product Name : Phospho-DNA PKcs (S2056) Recombinant Rabbit Monoclonal Antibody Predicted band size : 469 kDaObserved band size : 469 kDaSynonyms: DNA dependent protein kinase catalytic subunit antibody DNA PK…

Periphilin 1 Rabbit Polyclonal Antibody

Product Name : Periphilin 1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Gastric cancer antigen Ga50 antibody Periphilin 1 antibody Periphilin-1 antibody PPHLN_HUMAN antibody PPHLN1 antibodyFunction…

PTPRG Rabbit Polyclonal Antibody

Product Name : PTPRG Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Receptor-type tyrosine-protein phosphatase gamma PTPRG antibody Receptor-type tyrosine-protein phosphatase gamma PTPG antibodyFunction : The protein…

PSMA Mouse Monoclonal Antibody [A10A2]

Product Name : PSMA Mouse Monoclonal Antibody Predicted band size : 84 kDaObserved band size : 100/200 kDaSynonyms: Cell growth inhibiting protein 27 antibody Cell growth-inhibiting gene 27 protein antibody…

PPP1R3A Rabbit Polyclonal Antibody

Product Name : PPP1R3A Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: PPP1R3A antibody PP1G antibody Protein phosphatase 1 regulatory subunit 3A antibody Protein phosphatase 1 glycogen-associated…

POMC Recombinant Mouse Monoclonal Antibody [PD01-40]

Product Name : POMC Recombinant Mouse Monoclonal Antibody Predicted band size : Observed band size : Synonyms: ACTH antibody Adrenocorticotropic hormone antibody Adrenocorticotropin antibody alpha melanocyte stimulating hormone antibody Alpha…

PKN1 Mouse Monoclonal Antibody [B1-10H]

Product Name : PKN1 Mouse Monoclonal Antibody Predicted band size : Observed band size : Synonyms: DBK antibody PAK 1 antibody PAK-1 antibody PAK1 antibody PKC1 antibody PKN ALPHA antibody…

PHX2B Rabbit Polyclonal Antibody

Product Name : PHX2B Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: NBLST2 antibody NBPhox antibody Neuroblastoma paired type homeobox protein antibody Neuroblastoma Phox antibody Paired like…

PC-PLD1 Rabbit Polyclonal Antibody

Product Name : PC-PLD1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Choline phosphatase 1 antibody hPLD1 antibody Phosphatidylcholine-hydrolyzing phospholipase D1 antibody Phospholipase D1 antibody PLD 1…

PAR4 Rabbit Polyclonal Antibody

Product Name : PAR4 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: 2310001G03Rik antibody PAR 4 antibody PAR-4 antibody Pawr antibody PAWR_HUMAN antibody PRKC Apoptosis WT1 Regulator…

P2X6 Rabbit Polyclonal Antibody

Product Name : P2X6 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: ATP receptor antibody P2RX6 antibody P2RX6_HUMAN antibody P2RXL1 antibody P2X purinoceptor 6 antibody P2X6 antibody…

P2RY1 Mouse Monoclonal Antibody [4G5D6]

Product Name : P2RY1 Mouse Monoclonal Antibody Predicted band size : Observed band size : Synonyms: ATP receptor antibody P2 purinoceptor subtype Y1 antibody P2RY1 antibody P2RY1_HUMAN antibody P2Y purinoceptor…

Olfactory receptor 6B2 Rabbit Polyclonal Antibody

Product Name : Olfactory receptor 6B2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: OR6B2 antibody OR6B2P antibody Olfactory receptor 6B2 antibody Olfactory receptor OR2-1 antibodyFunction :…

Olfactory receptor 2AG1/2 Rabbit Polyclonal Antibody

Product Name : Olfactory receptor 2AG1/2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: OR2AG2 antibody OR2AG2P antibody Olfactory receptor 2AG2 antibody OR2AG1 antibody OR2AG3 antibody Olfactory…

Olfactory receptor 13H1 Rabbit Polyclonal Antibody

Product Name : Olfactory receptor 13H1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Olfactory receptor 13H1 OR13H1 antibodyFunction : Olfactory receptors interact with odorant molecules in…

5-Chloroethyl-6-chloro-1,3-dihydro-2H-indol-2-one

Product Name : 5-Chloroethyl-6-chloro-1,3-dihydro-2H-indol-2-oneSynonym : CAS: 118289-55-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy4-Bromobenzoic…

1-Hexanesulfonic acid sodium salt monohydrate, HPLC grade

Product Name : 1-Hexanesulfonic acid sodium salt monohydrate, HPLC gradeSynonym : Sodium 1-hexanesulfonate monohydrateCAS: 207300-91-2Formula: C6H13NaO3S · H2OMolecular Weight : 206.24Alternative CAS RN : 2832-45-3EC Number: 220-601-3MDL Number : MFCD00149549Storage…

3-Trifluoromethylbenzaldehyde

Product Name : 3-TrifluoromethylbenzaldehydeSynonym : CAS: 454-89-7Formula: C8H5F3OMolecular Weight : 174.12Alternative CAS RN : –EC Number: 207-228-1MDL Number : MFCD00003373Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29130000853-68-9…

2-Methyl-1-butanol

Product Name : 2-Methyl-1-butanolSynonym : sec-Butyl carbinol; (±)-2-Methyl-1-butanol; (+/-)-2-Methyl-1-butanol; Active amyl alcohol; DL-2-Methyl-1-butanolCAS: 137-32-6Formula: C5H12OMolecular Weight : 88.15Alternative CAS RN : –EC Number: 205-289-9MDL Number : MFCD00004743Storage Temperature : +20°CShipping…

5-(2-Fluorophenyl)tetrazole

Product Name : 5-(2-Fluorophenyl)tetrazoleSynonym : CAS: 50907-31-8Formula: C7H4Cl2N4Molecular Weight : 215.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00808036Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4-Methylbenzenesulfonyl…

N6-(2-Deoxy-D-glucos-2-yl)-L-lysine

Product Name : N6-(2-Deoxy-D-glucos-2-yl)-L-lysineSynonym : CAS: 112793-01-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1623432-63-2…

4-(Hydroxymethyl)piperidine

Product Name : 4-(Hydroxymethyl)piperidineSynonym : CAS: 6457-49-4Formula: C6H13NOMolecular Weight : 115.18Alternative CAS RN : –EC Number: –MDL Number : MFCD00174228Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29333999901,3-Benzoxazol-5-amine…

Mercaptosuccinic acid

Product Name : Mercaptosuccinic acidSynonym : Thiomalic acid; 2-Sulphanylbutane-1,4-dioic acidCAS: 70-49-5Formula: C4H6O4SMolecular Weight : 150.15Alternative CAS RN : –EC Number: 200-736-4MDL Number : MFCD00004860Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…

5-Hydroxy-1-tetralone

Product Name : 5-Hydroxy-1-tetraloneSynonym : CAS: 28315-93-7Formula: C10H10O2Molecular Weight : 162.19Alternative CAS RN : –EC Number: 248-958-0MDL Number : MFCD00001693Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 2914500025952-53-8…

Copper(ll) dioctadecanoate

Product Name : Copper(ll) dioctadecanoateSynonym : Copper octadecanoate; Octadecanoic acid, copper(2+) salt (2:1); AI3-00903; Cupric stearate; Copperbis(octadecanoate); Copper dioctadecanoate; Octadecanoic acid copper(2+) saltCAS: 660-60-6Formula: C36H70CuO4Molecular Weight : 630.48Alternative CAS RN…

1-Naphthylmethylamine

Product Name : 1-NaphthylmethylamineSynonym : 1-(Aminomethyl)naphthalene; 1-NaphthalenemethylamineCAS: 118-31-0Formula: C11H11NMolecular Weight : 157.22Alternative CAS RN : –EC Number: 204-244-0MDL Number : MFCD00004048Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

5-Amino-2-chloropyridine

Product Name : 5-Amino-2-chloropyridineSynonym : CAS: 5350-93-6Formula: C5H5ClN2Molecular Weight : 128.56Alternative CAS RN : –EC Number: 226-322-3MDL Number : MFCD00006243Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999Formula…

3-Aminophenylboronic acid monohydrate

Product Name : 3-Aminophenylboronic acid monohydrateSynonym : CAS: 206658-89-1Formula: C6H8BNO2H2OMolecular Weight : 154.96Alternative CAS RN : –EC Number: 250-189-0MDL Number : MFCD00149554Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…

(-)-alpha-Terpineol

Product Name : (-)-alpha-TerpineolSynonym : (S)-p-Menth-1-en-8-ol; (S)-2-(4-Methyl-3-cyclohexenyl)-2-propanol; α-TerpineolCAS: 10482-56-1Formula: C10H18OMolecular Weight : 154.25Alternative CAS RN : –EC Number: 202-680-6MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…

4-Bromobenzaldehyde

Product Name : 4-BromobenzaldehydeSynonym : CAS: 1122-91-4Formula: C7H5BrOMolecular Weight : 185.03Alternative CAS RN : –EC Number: 214-365-0MDL Number : MFCD00003377Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 291300004-(6-Bromopyridin-3-yl)morpholine…

3-Chloro-4-fluoropyridine

Product Name : 3-Chloro-4-fluoropyridineSynonym : CAS: 883107-69-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1203499-17-5…

Baicalin 7-b-D-glucuronide

Product Name : Baicalin 7-b-D-glucuronideSynonym : Baicalein 7-O-β-D-glucuronide; Baicalein 7-β-D-glucopyranosiduronate; 5,6-Dihydroxy-4-oxo-2-phenyl-4H-1-benzopyran-7-yl-β-D-glucopyranosiduronic acid; Baicalein 7-O-β-D-glucuronide; 5,6-Dihydroxy-4-oxygen-2-phenyl-4H-1-benzopyran-7-beta-D-glucuronide; Baicalin; 5,6-Dihydroxy-4-oxo-2-phenyl-4H-1-benzopyran-7-yl β-D-glucopyranosiduronic acidCAS: 21967-41-9Formula: C21H18O11Molecular Weight : 446.36Alternative CAS RN : –EC Number: –MDL…

6-Methoxy-2-tetralone

Product Name : 6-Methoxy-2-tetraloneSynonym : CAS: 2672-22-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyLumisterol…

2-Fluoro-5-trifluoromethylbenzonitrile

Product Name : 2-Fluoro-5-trifluoromethylbenzonitrileSynonym : CAS: 4088-84-0Formula: C8H3F4NMolecular Weight : 189.11Alternative CAS RN : –EC Number: –MDL Number : MFCD00061280Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –(S)-2-Methoxypropan-1-ol…

3-Fluorocinnamic acid

Product Name : 3-Fluorocinnamic acidSynonym : CAS: 458-46-8Formula: C9H7FO2Molecular Weight : 166.15Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…

Phorbol 12-myristate 13-acetate

Product Name : Phorbol 12-myristate 13-acetateSynonym : 12-O-Tetradecanoylphorbol 13-acetate; 4β,9α,12β,13α,20-Pentahydroxytiglia-1,6-dien-3-one 12-tetradecanoate 13-acetate; PMA; TPACAS: 16561-29-8Formula: C36H56O8Molecular Weight : 616.83Alternative CAS RN : –EC Number: –MDL Number : MFCD00036736Storage Temperature :…

1,5-Diazabicyclo(4.3.0)non-5-ene

Product Name : 1,5-Diazabicyclo(4.3.0)non-5-eneSynonym : DBNCAS: 3001-72-7Formula: C7H12N2Molecular Weight : 124.19Alternative CAS RN : –EC Number: 221-087-3MDL Number : MFCD00005554Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293359951217725-33-1…

Benzimidazole-2-boronic acid

Product Name : Benzimidazole-2-boronic acidSynonym : CAS: 475102-13-7Formula: C13H15BBrNO4Molecular Weight : 339.98Alternative CAS RN : –EC Number: –MDL Number : MFCD03701683Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

4-(Propoxycarbonyl)phenylboronic acid

Product Name : 4-(Propoxycarbonyl)phenylboronic acidSynonym : CAS: 91062-38-3Formula: C10H13BO4Molecular Weight : 208.02Alternative CAS RN : –EC Number: –MDL Number : MFCD06659852Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

2,2-Dimethylcyclopentanone

Product Name : 2,2-DimethylcyclopentanoneSynonym : CAS: 4541-32-6Formula: C7H12OMolecular Weight : 112.17Alternative CAS RN : –EC Number: –MDL Number : MFCD00049164Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code : 2914290090Formula…

5-Cyanothiophene-2-boronic acid

Product Name : 5-Cyanothiophene-2-boronic acidSynonym : CAS: 305832-67-1Formula: C5H4BNO2SMolecular Weight : 152.97Alternative CAS RN : –EC Number: –MDL Number : MFCD02094029Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

3-(5-Phenyl-2-pyridyl)-5-phenyl-1,2,4-triazine

Product Name : 3-(5-Phenyl-2-pyridyl)-5-phenyl-1,2,4-triazineSynonym : CAS: 108775-05-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyRibavirin…

Tepraloxydim

Product Name : TepraloxydimSynonym : trans-2--3-hydroxy-5-(tetrahydro-2H-pyran-4-yl)-2-cyclohexen-1-oneCAS: 149979-41-9Formula: C17H24ClNO4Molecular Weight : 341.83Alternative CAS RN : –EC Number: –MDL Number : MFCD03792787Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293299003,5-Dibromo-1H-pyrazole-4-carbonitrile…

2-Cyanophenylboronic acid

Product Name : 2-Cyanophenylboronic acidSynonym : CAS: 138642-62-3Formula: C7H6BNO2Molecular Weight : 146.94Alternative CAS RN : –EC Number: –MDL Number : MFCD01632208Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Methyl β-L-daunosaminide hydrochloride

Product Name : Methyl β-L-daunosaminide hydrochlorideSynonym : Daunosamine β-methyl glycosideCAS: 115388-97-1Formula: C7H15NO3 · HClMolecular Weight : 197.66Alternative CAS RN : –EC Number: –MDL Number : MFCD00270034Storage Temperature : –Shipping Temperature…

8-Hydroxyquinoline-2-sulfonic acid monohydrate

Product Name : 8-Hydroxyquinoline-2-sulfonic acid monohydrateSynonym : CAS: 20946-17-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…

Leupeptin trifluoroacetate salt

Product Name : Leupeptin trifluoroacetate saltSynonym : Acetyl-Leu-Leu-Arg-al trifluoroacetate saltCAS: 147385-61-3Formula: C20H38N6O4 · xC2HF3O2Molecular Weight : 426.55 (free base bAlternative CAS RN : –EC Number: –MDL Number : MFCD00133458Storage Temperature…

5-Fluoro-2-trifluoromethylphenylboronic acid

Product Name : 5-Fluoro-2-trifluoromethylphenylboronic acidSynonym : CAS: 928053-97-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

EM20-25

Product Name : EM20-25Synonym : 5-(6-Chloro-2,4-dioxo-1,3,4,10-tetrahydro-2H-9-oxa-1,3-diaza-anthracen-10-yl)-pyrimidine-2,4,6-trioneCAS: 141266-44-6Formula: C15H9ClN4O6Molecular Weight : 376.71Alternative CAS RN : –EC Number: –MDL Number : MFCD00624842Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –886593-45-9…

3-Chloro-2-fluorobenzaldehyde

Product Name : 3-Chloro-2-fluorobenzaldehydeSynonym : CAS: 85070-48-0Formula: C7H4ClFOMolecular Weight : 158.56Alternative CAS RN : –EC Number: –MDL Number : MFCD01631571Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy1-Boc-3-Bromopiperidine…

5-Bromoindole-2-carboxylic acid ethyl ester

Product Name : 5-Bromoindole-2-carboxylic acid ethyl esterSynonym : CAS: 16732-70-0Formula: C11H10BrNO2Molecular Weight : 268.11Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…

3,5-Dimethylphenylboronic acid

Product Name : 3,5-Dimethylphenylboronic acidSynonym : CAS: 172975-69-8Formula: C8H11BO2Molecular Weight : 149.99Alternative CAS RN : –EC Number: –MDL Number : MFCD00185689Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Berberine hydrochloride

Product Name : Berberine hydrochlorideSynonym : Natural Yellow 18; Berberine chloride form; Berberine chloride hydrate; Natural yellow 18 hydrateCAS: 633-65-8Formula: C20H18ClNO4Molecular Weight : 371.82Alternative CAS RN : 2086-83-1, 141433-60-5EC Number:…

Methyl 3-Acetamido-4,6-O-benzylidene-2,3-dideoxy-α-D-arabino-hexopyranoside

Product Name : Methyl 3-Acetamido-4,6-O-benzylidene-2,3-dideoxy-α-D-arabino-hexopyranosideSynonym : CAS: 4115-63-3Formula: Molecular Weight : 307.34Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…

Benzotriazole

Product Name : BenzotriazoleSynonym : 1,2,3-Benzotriazole; 1H-Benzotriazole ; AzimidobenzeneCAS: 95-14-7Formula: C6H5N3Molecular Weight : 119.13Alternative CAS RN : –EC Number: 202-394-1MDL Number : MFCD00005699Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…

5-Methylisatin

Product Name : 5-MethylisatinSynonym : CAS: 608-05-9Formula: C9H7NO2Molecular Weight : 161.16Alternative CAS RN : –EC Number: 210-152-1MDL Number : MFCD00005721Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29337900Price…

2-Bromobenzyl bromide

Product Name : 2-Bromobenzyl bromideSynonym : CAS: 3433-80-5Formula: C7H6Br2Molecular Weight : 249.94Alternative CAS RN : –EC Number: 222-334-8MDL Number : MFCD00000173Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

2-Bromobenzylamine hydrochloride

Product Name : 2-Bromobenzylamine hydrochlorideSynonym : CAS: 5465-63-4Formula: C7H8BrNHClMolecular Weight : 222.52Alternative CAS RN : –EC Number: –MDL Number : MFCD00012853Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

1-Nonadecanol

Product Name : 1-NonadecanolSynonym : CAS: 1454-84-8Formula: CH3(CH2)18OHMolecular Weight : 284.52Alternative CAS RN : –EC Number: 215-930-4MDL Number : MFCD00002824Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29051900980Buy2-(4-Hydroxy-1H-indol-3-yl)acetic…

5-Bromo-2,3-difluorophenol

Product Name : 5-Bromo-2,3-difluorophenolSynonym : CAS: 186590-26-1Formula: C6H3BrF2OMolecular Weight : 208.99Alternative CAS RN : –EC Number: –MDL Number : MFCD01631350Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…

Methyl 14(S);15(S)-epoxy-13(R)-hydroxy-(5Z,8Z,11Z)-eicosatrienoate

Product Name : Methyl 14(S);15(S)-epoxy-13(R)-hydroxy-(5Z,8Z,11Z)-eicosatrienoateSynonym : (E)-4-Hydroxynonenal-dimethylacetal; 4-HNE-DMACAS: Formula: C11H22O3Molecular Weight : 202.29Alternative CAS RN : –EC Number: –MDL Number : MFCD04040010Storage Temperature : -20°CShipping Temperature : Dry iceHarmonised Tariff…

5-Trifluoromethylindole

Product Name : 5-TrifluoromethylindoleSynonym : CAS: 100846-24-0Formula: C9H6F3NMolecular Weight : 185.15Alternative CAS RN : –EC Number: –MDL Number : MFCD03095341Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3-Cyano-2-phenylpropanoic…

Calcium Mitiglinide

Product Name : Calcium MitiglinideSynonym : CAS: 145525-41-3Formula: Molecular Weight : Alternative CAS RN : 207844-01-7 (2H2O)EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…

Ethyl 2-ethylacetoacetate

Product Name : Ethyl 2-ethylacetoacetateSynonym : CAS: 607-97-6Formula: C8H14O3Molecular Weight : 158.20Alternative CAS RN : –EC Number: 210-151-6MDL Number : MFCD00039898Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

3-Hydroxybenzaldehyde

Product Name : 3-HydroxybenzaldehydeSynonym : CAS: 100-83-4Formula: C7H6O2Molecular Weight : 122.12Alternative CAS RN : –EC Number: 202-892-9MDL Number : MFCD00003368Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29124900Pyrene-4,5,9,10-tetraone…

Z-Ile-Glu(O-t-butyl)-Ala-Leucinal

Product Name : Z-Ile-Glu(O-t-butyl)-Ala-LeucinalSynonym : N--L-isoleucyl-L-α-glutamyl-tert-butyl ester-N--L-alaninamide; PSICAS: 158442-41-2Formula: C32H50N4O8Molecular Weight : 618.76Alternative CAS RN : –EC Number: –MDL Number : MFCD00671409Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff…

L-Iduronic acid-1,6-13C2

Product Name : L-Iduronic acid-1,6-13C2Synonym : CAS: Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

4-Methoxyphenylhydrazine hydrochloride

Product Name : 4-Methoxyphenylhydrazine hydrochlorideSynonym : CAS: 19501-58-7Formula: C7H10N2OHClMolecular Weight : 174.63Alternative CAS RN : –EC Number: 243-115-3MDL Number : MFCD00012945Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Olomoucine

Product Name : OlomoucineSynonym : 2-(Hydroxyethylamino)-6-benzylamino-9-methylpurineCAS: 101622-51-9Formula: C15H18N6OMolecular Weight : 298.35Alternative CAS RN : –EC Number: –MDL Number : MFCD00189360Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Formula…

3-Chloromethylpyridine hydrochloride (3-Picolylchloride hydrochloride)

Product Name : 3-Chloromethylpyridine hydrochloride (3-Picolylchloride hydrochloride)Synonym : CAS: 6959-48-4Formula: C6H6ClNHClMolecular Weight : 164.04Alternative CAS RN : –EC Number: 230-150-4MDL Number : MFCD00012818Storage Temperature : –Shipping Temperature : –Harmonised Tariff…

Aminomethylphosphonic acid (AMPA)

Product Name : Aminomethylphosphonic acid (AMPA)Synonym : AMPACAS: 1066-51-9Formula: CH6NO3PMolecular Weight : 111.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00008105Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…

5-Iodosalicylic acid

Product Name : 5-Iodosalicylic acidSynonym : CAS: 119-30-2Formula: C7H5IO3Molecular Weight : 264.02Alternative CAS RN : –EC Number: 204-313-5MDL Number : MFCD00002458Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Pyridine-3-boronic acid hydrochloride

Product Name : Pyridine-3-boronic acid hydrochlorideSynonym : CAS: 1692-25-7Formula: C5H6BNO2Molecular Weight : 122.92Alternative CAS RN : –EC Number: –MDL Number : MFCD00674177Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…

N-(4-Amino-2-chlorophenyl)phthalimide

Product Name : N-(4-Amino-2-chlorophenyl)phthalimideSynonym : CAS: 19348-53-9Formula: C14H9ClN2O2Molecular Weight : 272.69Alternative CAS RN : –EC Number: –MDL Number : MFCD00658249Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…

Diethylenetriamine pentaacetic acid

Product Name : Diethylenetriamine pentaacetic acidSynonym : (Carboxymethylimino)bis(ethylenenitrilo)tetraacetic acid; N,N-Bis(2-ethyl)glycine; DETAPAC; DTPA; Penta(carboxymethyl)diethylenetriamine; Pentetic acidCAS: 67-43-6Formula: C14H23N3O10Molecular Weight : 393.35Alternative CAS RN : –EC Number: 200-652-8MDL Number : MFCD00004289Storage Temperature…

Androstane-3-a,17 b-diol 3-O-b-D-glucuronide-D3

Product Name : Androstane-3-a,17 b-diol 3-O-b-D-glucuronide-D3Synonym : CAS: 148616-25-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…

5-Amino-3-methylisoxazole

Product Name : 5-Amino-3-methylisoxazoleSynonym : CAS: 14678-02-5Formula: C4H6N2OMolecular Weight : 98.11Alternative CAS RN : –EC Number: 238-719-9MDL Number : MFCD00003151Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Bromo-PEG1-CH2-Boc…

Syringic acid

Product Name : Syringic acidSynonym : 3,5-Dimethoxy-4-hydroxybenzoic acid; 4-Hydroxy-3,5-dimethoxy-benzoic acid; Gallic acid 3,5-dimethyl ether; 4-Hydroxy-3,5-dimethoxybenzoic acidCAS: 530-57-4Formula: C9H10O5Molecular Weight : 198.17Alternative CAS RN : –EC Number: 208-486-8MDL Number : MFCD00002552Storage…

Quinazoline

Product Name : QuinazolineSynonym : CAS: 253-82-7Formula: C8H6N2Molecular Weight : 130.15Alternative CAS RN : –EC Number: 205-965-3MDL Number : MFCD00006712Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29335995Formula…

Cyclopropanecarbonitrile

Product Name : CyclopropanecarbonitrileSynonym : CAS: 5500-21-0Formula: C4H5NMolecular Weight : 67.09Alternative CAS RN : –EC Number: 226-836-8MDL Number : MFCD00001269Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690951-(2-Hydroxy-5-iodophenyl)ethan-1-one…

Trichloroacetyl isocyanate

Product Name : Trichloroacetyl isocyanateSynonym : CAS: 3019-71-4Formula: C3Cl3NO2Molecular Weight : 188.40Alternative CAS RN : –EC Number: 221-165-7MDL Number : MFCD00002033Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

S(+)-Propylene glycol

Product Name : S(+)-Propylene glycolSynonym : (S)-(+)-1,2-Propanediol; (S)-(+)-1,2-Dihydroxypropane; (S)-(+)-Propylene GlycolCAS: 4254-15-3Formula: C3H8O2Molecular Weight : 76.10Alternative CAS RN : –EC Number: –MDL Number : MFCD00004539Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…

Lead(IV) oxide

Product Name : Lead(IV) oxideSynonym : Lead oxide; Lead (su)peroxide; Lead dioxide; Lead peroxideCAS: 1309-60-0Formula: PbO2Molecular Weight : 239.19Alternative CAS RN : –EC Number: 215-174-5MDL Number : MFCD00011165Storage Temperature :…

8-Chloroadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer

Product Name : 8-Chloroadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomerSynonym : Rp-8-Cl-cAMPSCAS: 142754-27-6Formula: C10H10ClN5O5PSNaMolecular Weight : 401.70Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…

2,6-Dihydroxybenzoic acid

Product Name : 2,6-Dihydroxybenzoic acidSynonym : CAS: 303-07-1Formula: C7H6O4Molecular Weight : 154.12Alternative CAS RN : –EC Number: 206-134-8MDL Number : MFCD00002462Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

1-Butanol

Product Name : 1-ButanolSynonym : n-Butanol; Butyl alcoholCAS: 71-36-3Formula: CH3(CH2)3OHMolecular Weight : 74.12Alternative CAS RN : –EC Number: 200-751-6MDL Number : MFCD00002964Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…

2-Nitrophenyl b-D-galactopyranoside

Product Name : 2-Nitrophenyl b-D-galactopyranosideSynonym : o-Nitrophenyl β-D-galactopyranoside; o-Nitrophenyl beta-D-galactopyranoside; 2-Nitrophenyl beta-D-galactopyranoside; o-Nitrophenyl beta-D-galactoside; ONPG; ONP beta-D-galactopyranosideCAS: 369-07-3Formula: C12H15NO8Molecular Weight : 301.25Alternative CAS RN : –EC Number: 206-716-1MDL Number :…

SU 5416

Product Name : SU 5416Synonym : 1,3-Dihydro-3--2H-indol-2-oneCAS: 204005-46-9Formula: C15H14N2OMolecular Weight : 238.28Alternative CAS RN : –EC Number: –MDL Number : MFCD01940922Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…

2-Bromo-3,5-dichloropyridine

Product Name : 2-Bromo-3,5-dichloropyridineSynonym : CAS: 14482-51-0Formula: C5H2BrCl2NMolecular Weight : 226.89Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Di(1H-pyrrol-2-yl)methane…

Cochliodinol

Product Name : CochliodinolSynonym : CAS: 11051-88-0Formula: Molecular Weight : 506.6Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –728034-12-6…

Thiophene-2-carboxylic acid hydrazide

Product Name : Thiophene-2-carboxylic acid hydrazideSynonym : CAS: 2361-27-5Formula: C5H6N2OSMolecular Weight : 142.18Alternative CAS RN : –EC Number: 219-107-0MDL Number : MFCD00005435Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…

Phenanthrene

Product Name : PhenanthreneSynonym : CAS: 85-01-8Formula: C14H10Molecular Weight : 178.23Alternative CAS RN : –EC Number: 201-581-5MDL Number : MFCD00001168Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : 29029000856412-22-1…

E-4031

Product Name : E-4031Synonym : N--4-piperidinyl]carbonyl]phenyl]methanesulfonamide dihydrochlorideCAS: 113559-13-0Formula: C21H27N3O3S · 2HClMolecular Weight : 474.44Alternative CAS RN : –EC Number: –MDL Number : MFCD01754739Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff…

4-Trifluoromethylphenylacetic acid

Product Name : 4-Trifluoromethylphenylacetic acidSynonym : CAS: 32857-62-8Formula: C9H7F3O2Molecular Weight : 204.15Alternative CAS RN : –EC Number: 251-263-5MDL Number : MFCD00004352Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

5-Chloro-2-methylphenylboronic acid

Product Name : 5-Chloro-2-methylphenylboronic acidSynonym : CAS: 148839-33-2Formula: C7H8BClO2Molecular Weight : 170.40Alternative CAS RN : –EC Number: –MDL Number : MFCD03411939Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

2,4,5-Triamino-6-hydroxypyrimidine

Product Name : 2,4,5-Triamino-6-hydroxypyrimidineSynonym : CAS: 51324-37-9Formula: C4H9Cl2N5OMolecular Weight : 214.05Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2,4-Dibromo-3-methylpyridine…

4-Benzyloxyaniline hydrochloride

Product Name : 4-Benzyloxyaniline hydrochlorideSynonym : CAS: 51388-20-6Formula: C13H13NOHClMolecular Weight : 235.72Alternative CAS RN : –EC Number: 257-170-6MDL Number : MFCD00012995Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Magnesium chloride hexahydrate

Product Name : Magnesium chloride hexahydrateSynonym : CAS: 7791-18-6Formula: MgCl2 · 6H2OMolecular Weight : 203.30Alternative CAS RN : –EC Number: 232-094-6MDL Number : MFCD00149781Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…

4-Nitrophenylacetonitrile

Product Name : 4-NitrophenylacetonitrileSynonym : CAS: 555-21-5Formula: C8H6N2O2Molecular Weight : 162.15Alternative CAS RN : –EC Number: 209-085-0MDL Number : MFCD00007372Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690952-chloro-4,6-dimethoxypyridine…

5,6-Difluoroindole-2-carboxylic acid

Product Name : 5,6-Difluoroindole-2-carboxylic acidSynonym : CAS: 169674-35-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

N-Acetyl-D-glucosamine 6-acetate

Product Name : N-Acetyl-D-glucosamine 6-acetateSynonym : CAS: 131832-93-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

2-Hydroxy-3-nitro-4-picoline (2-Hydroxy-4-methyl-3-nitropyridine)

Product Name : 2-Hydroxy-3-nitro-4-picoline (2-Hydroxy-4-methyl-3-nitropyridine)Synonym : CAS: 21901-18-8Formula: C6H6N2O3Molecular Weight : 154.12Alternative CAS RN : –EC Number: –MDL Number : MFCD00010689Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Phenserine

Product Name : PhenserineSynonym : (−)-N-Phenylcarbamoyleseroline; 1,2,3,3a,8,8a-Hexahydro-1,3a,8-trimethyl-pyrroloindol-5-ol phenylcarbamate (ester)CAS: 101246-66-6Formula: C20H23N3O2Molecular Weight : 337.42Alternative CAS RN : –EC Number: –MDL Number : MFCD00672748Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff…

11-alpha-Hydroxyprogesterone

Product Name : 11-alpha-HydroxyprogesteroneSynonym : (11a)-11-Hydroxypregn-4-ene-3,20-dione; 11-Hydroxyprogesterone; 4-Pregnene-11a-ol-3,20-dione; 11α-Hydroxy Progesterone; 11α-Hydroxyprogesterone; 11-α-HydroxyprogesteroneCAS: 80-75-1Formula: C21H30O3Molecular Weight : 330.46Alternative CAS RN : –EC Number: 201-306-9MDL Number : –Storage Temperature : +20°CShipping Temperature…

Tungsten hexacarbonyl

Product Name : Tungsten hexacarbonylSynonym : CAS: 14040-11-0Formula: C6O6WMolecular Weight : 351.91Alternative CAS RN : –EC Number: 237-880-2MDL Number : MFCD00011462Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…

Elaterinide

Product Name : ElaterinideSynonym : CAS: 1398-78-3Formula: C38H54O13Molecular Weight : 718.83Alternative CAS RN : –EC Number: 215-745-9MDL Number : MFCD00046215Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : 29389090941-43-5…

3-Isopropylbenzoic acid

Product Name : 3-Isopropylbenzoic acidSynonym : CAS: 5651-47-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

3-Bromoindazole

Product Name : 3-BromoindazoleSynonym : CAS: 40598-94-5Formula: C7H5BrN2Molecular Weight : 197.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00159926Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293399809003-Chloro-5-nitro-1H-pyrazole…

Crosstide

Product Name : CrosstideSynonym : CAS: 171783-05-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : MFCD03787963Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –1243361-03-6…

4-Methylumbelliferyl b-D-glucopyranoside

Product Name : 4-Methylumbelliferyl b-D-glucopyranosideSynonym : MUD; 4-Methylumbelliferyl beta-D-glucopyranoside; 4-Methylumbelliferyl β-D-glucopyranoside; 4MU beta-D-glucopyranosideCAS: 18997-57-4Formula: C16H18O8 · H2OMolecular Weight : 356.3Alternative CAS RN : –EC Number: 242-736-7MDL Number : MFCD00063694Storage Temperature…

BPD

Product Name : BPDSynonym : 3-(1,3-benzodioxol-5-yl)-4-phenyl-2,5-FurandioneCAS: 213481-12-0Formula: C17H10O5Molecular Weight : 294.26Alternative CAS RN : –EC Number: –MDL Number : MFCD22666591Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –1-Bromo-3-fluoro-2-methyl-4-nitrobenzene…

N-(tert-Butyl)hydroxylamine hydrochloride

Product Name : N-(tert-Butyl)hydroxylamine hydrochlorideSynonym : CAS: 57497-39-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

(tert-Butylimino)tris(pyrrolidino)phosphorane

Product Name : (tert-Butylimino)tris(pyrrolidino)phosphoraneSynonym : CAS: 161118-67-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1539-42-0…

6-Nitroquinoline

Product Name : 6-NitroquinolineSynonym : CAS: 613-50-3Formula: C9H6N2O2Molecular Weight : 174.16Alternative CAS RN : –EC Number: 210-346-6MDL Number : MFCD00006799Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29334990180532-52-9…

2-Bromothiazole

Product Name : 2-BromothiazoleSynonym : CAS: 3034-53-5Formula: C3H2BrNSMolecular Weight : 164.02Alternative CAS RN : –EC Number: 221-229-4MDL Number : MFCD00005316Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29341000Thienopyridin-5-amine…

1-Benzoylpiperazine

Product Name : 1-BenzoylpiperazineSynonym : CAS: 13754-38-6Formula: C11H14N2OMolecular Weight : 190.24Alternative CAS RN : –EC Number: –MDL Number : MFCD00810192Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3,5-Dichloropyridopyrazine…

trans-3-Hexenoic acid

Product Name : trans-3-Hexenoic acidSynonym : CAS: 1577-18-0Formula: C6H10O2Molecular Weight : 114.14Alternative CAS RN : –EC Number: 216-417-8MDL Number : MFCD00002786Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

SBFI-AM

Product Name : SBFI-AMSynonym : Sodium indicator SBFI-AM; Sodium-binding benzofuran isophthalate-AMCAS: 129423-53-6Formula: C56H58N2O23Molecular Weight : 1127.06Alternative CAS RN : –EC Number: –MDL Number : MFCD00082576Storage Temperature : -20°CShipping Temperature :…

1-Hexadecanesulfonic acid sodium salt

Product Name : 1-Hexadecanesulfonic acid sodium saltSynonym : Cetylsulfonic acid sodium salt; Sodium 1-Hexadecanesulfonate; Hexadecylsulfonic acid sodium salt; Sodium cetylsulfonateCAS: 15015-81-3Formula: C16H33SO3NaMolecular Weight : 328.49Alternative CAS RN : –EC Number:…

4-n-Butylphenol

Product Name : 4-n-ButylphenolSynonym : CAS: 1638-22-8Formula: C10H14OMolecular Weight : 150.22Alternative CAS RN : –EC Number: 216-672-5MDL Number : MFCD00041750Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Metformin…

Methyl 4-hydroxybenzoate sodium salt

Product Name : Methyl 4-hydroxybenzoate sodium saltSynonym : Sodium methyl 4-hydroxybenzoate; Methylis parahydroxybenzoas natricum; Sodium methyl paraben; Sodium methylparabenCAS: 5026-62-0Formula: C8H7NaO3Molecular Weight : 174.13Alternative CAS RN : –EC Number: 225-714-1MDL…

Benzyl 2,6-di-O-acetyl-3,4-O-isopropylidene-β-D-galactopyranoside

Product Name : Benzyl 2,6-di-O-acetyl-3,4-O-isopropylidene-β-D-galactopyranosideSynonym : CAS: 16741-10-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Thiophene-3-carboxaldehyde

Product Name : Thiophene-3-carboxaldehydeSynonym : CAS: 498-62-4Formula: C5H4OSMolecular Weight : 112.15Alternative CAS RN : –EC Number: 207-865-5MDL Number : MFCD00005466Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293499901207294-92-5…

3-Methyl-1-butanol

Product Name : 3-Methyl-1-butanolSynonym : Isoamyl alcohol; Isopentyl alcohol; Isobutylcarbinol; IsopentanolCAS: 123-51-3Formula: C5H12OMolecular Weight : 88.15Alternative CAS RN : –EC Number: 204-633-5MDL Number : MFCD00002934Storage Temperature : +20°CShipping Temperature :…

4-(3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio)-1,3-benzenedisulfonate

Product Name : 4-(3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio)-1,3-benzenedisulfonateSynonym : CAS: 150849-52-8Formula: C19H11IN5O8S2•NaMolecular Weight : 651.35Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff Code :…

(S)-(+)-2-Hexanol

Product Name : (S)-(+)-2-HexanolSynonym : CAS: 52019-78-0Formula: C6H14OMolecular Weight : 102.18Alternative CAS RN : –EC Number: –MDL Number : MFCD00065955Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Ethynylpyrazine…

2-Amino-5,6-dihydro-6-methyl-4H-1,3-thiazine

Product Name : 2-Amino-5,6-dihydro-6-methyl-4H-1,3-thiazineSynonym : AMTCAS: 1121-91-1Formula: C5H10N2S · HClMolecular Weight : 166.67Alternative CAS RN : –EC Number: –MDL Number : MFCD00717539Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code…

(R)-2-Methylpyrrolidine

Product Name : (R)-2-MethylpyrrolidineSynonym : CAS: 41720-98-3Formula: C5H11NMolecular Weight : 85.15Alternative CAS RN : –EC Number: –MDL Number : MFCD07783026Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 29339980Formula…

2-Carboxy-5-fluorophenylboronic acid

Product Name : 2-Carboxy-5-fluorophenylboronic acidSynonym : CAS: 874290-62-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Tetrahydro-4H-pyran-4-one

Product Name : Tetrahydro-4H-pyran-4-oneSynonym : CAS: 29943-42-8Formula: C5H8O2Molecular Weight : 100.12Alternative CAS RN : –EC Number: 249-967-2MDL Number : MFCD00006581Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29329900Potassium…

(R)-(-)-2-Chloromandelic acid

Product Name : (R)-(-)-2-Chloromandelic acidSynonym : CAS: 52950-18-2Formula: C8H7ClO3Molecular Weight : 186.60Alternative CAS RN : –EC Number: –MDL Number : MFCD00798429Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…

Ciprofibrate acyl-β-D-glucuronide

Product Name : Ciprofibrate acyl-β-D-glucuronideSynonym : CAS: 102623-15-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

2,2-Dimethylbutyric acid

Product Name : 2,2-Dimethylbutyric acidSynonym : CAS: 595-37-9Formula: C6H12O2Molecular Weight : 116.16Alternative CAS RN : –EC Number: 209-865-0MDL Number : MFCD00004200Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

1,2-Dimyristoyl-sn-glycero-3-phosphocholine

Product Name : 1,2-Dimyristoyl-sn-glycero-3-phosphocholineSynonym : 1,2-Ditetradecanoyl-sn-glycero-3-phosphocholine; 3-sn-Phosphatidylcholine, 1,2-dimyristoyl; L-β,γ-Dimyristoyl-α-lecithin; 3,5,9-Trioxa-4-phosphatricosan-1-aminium; 4-hydroxy-N,N,N-trimethyl-10-oxo-7--, hydroxide, inner salt; 1,2-Dimyristoyl-sn-glycerol-3; (R)-2,3-Bis(tetradecanoyloxy)propyl phosphate; DMPC; L-b,γ-Dimyristoyl-a-lecithinCAS: 18194-24-6Formula: C36H72NO8PMolecular Weight : 677.93Alternative CAS RN : –EC Number: 242-085-9MDL…

2-Acetylphenylboronic acid

Product Name : 2-Acetylphenylboronic acidSynonym : CAS: 308103-40-4Formula: C8H9BO3Molecular Weight : 163.97Alternative CAS RN : –EC Number: –MDL Number : MFCD01321263Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

3,5-Dimethoxybenzaldehyde

Product Name : 3,5-DimethoxybenzaldehydeSynonym : CAS: 7311-34-4Formula: C9H10O3Molecular Weight : 166.18Alternative CAS RN : –EC Number: 230-772-6MDL Number : MFCD00003366Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29124900N1,N1-Diphenylbenzene-1,4-diamine…

Dicamba

Product Name : DicambaSynonym : 3,6-dichloro-2-methoxybenzoic acid; 3,6-Dichloro-o-anisic acid; MDBACAS: 1918-00-9Formula: C8H6Cl2O3Molecular Weight : 221.03Alternative CAS RN : –EC Number: 217-635-6MDL Number : MFCD00055283Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…

N,N-Bis(2-hydroxyethyl)-p-toluidine

Product Name : N,N-Bis(2-hydroxyethyl)-p-toluidineSynonym : CAS: 3077-12-1Formula: C11H17NO2Molecular Weight : 195.26Alternative CAS RN : –EC Number: 221-359-1MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 2922190090846549-37-9…

2-Hydroxyethylhydrazine

Product Name : 2-HydroxyethylhydrazineSynonym : CAS: 109-84-2Formula: HOCH2CH2NHNH2Molecular Weight : 76.10Alternative CAS RN : –EC Number: 203-711-6MDL Number : MFCD00007623Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29280090236406-49-8…

2-Chloro-5-fluoropyridine

Product Name : 2-Chloro-5-fluoropyridineSynonym : CAS: 31301-51-6Formula: C5H3ClFNMolecular Weight : 131.54Alternative CAS RN : –EC Number: –MDL Number : MFCD03095332Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Mal-PEG4-OH…

5-Bromo-2′-deoxyuridine 5′-triphosphate sodium salt

Product Name : 5-Bromo-2′-deoxyuridine 5′-triphosphate sodium saltSynonym : 5-BrdUTPCAS: 102212-99-7Formula: C9H14BrN2O14P3Molecular Weight : 547.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00057405Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff…

Saikosaponin A

Product Name : Saikosaponin ASynonym : CAS: 20736-09-8Formula: C42H68O13Molecular Weight : 780.98Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

1-Pentanesulfonic acid sodium salt, HPLC grade

Product Name : 1-Pentanesulfonic acid sodium salt, HPLC gradeSynonym : Sodium pentanesulfonate ; Sodium 1-pentanesulfonateCAS: 22767-49-3Formula: CH3(CH2)4SO3NaMolecular Weight : 174.19Alternative CAS RN : 207605-40-1EC Number: 245-208-4MDL Number : MFCD00007541Storage Temperature…

4-methylhydratropaldehyde

Product Name : 4-methylhydratropaldehydeSynonym : CAS: 99-72-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29122900Price…

Calcium carbonate, technical

Product Name : Calcium carbonate, technicalSynonym : ChalkCAS: 471-34-1Formula: CaCO3Molecular Weight : 100.09Alternative CAS RN : 1317-65-3EC Number: 207-439-9MDL Number : MFCD00010906Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…

(S)-(-)-4-Benzyl-1,3-oxazolidine-2-thione

Product Name : (S)-(-)-4-Benzyl-1,3-oxazolidine-2-thioneSynonym : CAS: 145588-94-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –5-Amino-2-(4-aminophenyl)benzimidazole…

4-Biphenylacetic acid

Product Name : 4-Biphenylacetic acidSynonym : CAS: 5728-52-9Formula: C14H12O2Molecular Weight : 212.25Alternative CAS RN : –EC Number: 227-233-2MDL Number : MFCD00004351Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…

1,3-Dibromoadamantane

Product Name : 1,3-DibromoadamantaneSynonym : CAS: 876-53-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –76578-90-0…

Aurothioglucose hydrate

Product Name : Aurothioglucose hydrateSynonym : Gold thioglucose; Solganal; SolganolCAS: 12192-57-3Formula: C6H11AuO5S · xH2OMolecular Weight : 392.18 (anhydrous)Alternative CAS RN : –EC Number: 235-365-7MDL Number : –Storage Temperature : +4°CShipping…

4-Amino-2-methylphenol

Product Name : 4-Amino-2-methylphenolSynonym : CAS: 2835-96-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29222900N6-Diazo-L-Fmoc-lysine…

3-Amino-2-nitropyridine

Product Name : 3-Amino-2-nitropyridineSynonym : CAS: 13269-19-7Formula: C5H5N3O2Molecular Weight : 139.11Alternative CAS RN : –EC Number: 236-260-9MDL Number : MFCD00044102Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29333999903-(Benzyloxy)cyclobutanone…

2-(Trimethylsilyl)-1H-1,2,3-triazole

Product Name : 2-(Trimethylsilyl)-1H-1,2,3-triazoleSynonym : CAS: 13518-80-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –169566-81-8…

a-D-Glucuronic acid 1-phosphate tripotassium salt pentahydrate

Product Name : a-D-Glucuronic acid 1-phosphate tripotassium salt pentahydrateSynonym : CAS: 103213-29-2Formula: C6H11O10P.3K.3(H2O)Molecular Weight : 553.55Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature :…

2-Fluoro-3-trifluoromethylbenzonitrile

Product Name : 2-Fluoro-3-trifluoromethylbenzonitrileSynonym : CAS: 146070-35-1Formula: C8H3F4NMolecular Weight : 189.11Alternative CAS RN : –EC Number: –MDL Number : MFCD00061152Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…

Benzoylacetonitrile

Product Name : BenzoylacetonitrileSynonym : CAS: 614-16-4Formula: C9H7NOMolecular Weight : 145.16Alternative CAS RN : –EC Number: 210-369-1MDL Number : MFCD00001942Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690951-Hydroxyhept-6-yn-3-one…

2-Amino-2-thiazoline hydrochloride

Product Name : 2-Amino-2-thiazoline hydrochlorideSynonym : CAS: 3882-98-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Benzyl benzoate

Product Name : Benzyl benzoateSynonym : Benzoic acid benzyl ester; Phenylmethyl benzoate; Phenylmethyl benzoateCAS: 120-51-4Formula: C14H12O2Molecular Weight : 212.25Alternative CAS RN : –EC Number: 204-402-9MDL Number : MFCD00003075Storage Temperature :…

3-Amino-5-nitrobenzoic acid

Product Name : 3-Amino-5-nitrobenzoic acidSynonym : CAS: 618-84-8Formula: C7H6N2O4Molecular Weight : 182.14Alternative CAS RN : –EC Number: –MDL Number : MFCD00017025Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

Endomorphin 2

Product Name : Endomorphin 2Synonym : CAS: 141801-26-5Formula: C32H37N5O5Molecular Weight : 571.67Alternative CAS RN : –EC Number: –MDL Number : MFCD01321064Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…

3-Hydroxythiophenol (3-Mercaptophenol)

Product Name : 3-Hydroxythiophenol (3-Mercaptophenol)Synonym : CAS: 40248-84-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

CD-3

Product Name : CD-3Synonym : 4-(N-Ethyl-N-2-methanesulfonylaminoethyl)-2-methylphenylenediamine; 4-(N-ethyl-N-2-methanesulphonylaminoethyl)-2-methylphenylenediamine sesquisulphate; N-(2-(4-amino-N-ethyl-m-toluidino)ethyl)methanesulphonamide sesquisulphateCAS: 25646-71-3Formula: C11H18N2O4SMolecular Weight : 274.34Alternative CAS RN : 24567-76-8EC Number: 247-161-5MDL Number : MFCD00036418Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…

Disodium hydrogen citrate sesquihydrate

Product Name : Disodium hydrogen citrate sesquihydrateSynonym : Disodium citrate sesquihydrate; Citric acid disodium salt sesquihydrate; Disodium hydrogen citrate hydrate; Disodium citrate hydrate; Di-Sodium hydrogen citrate sesquihydrate; Citric acid, disodium…

6-Methoxycoumarin

Product Name : 6-MethoxycoumarinSynonym : CAS: 17372-53-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –6-Aminonaphthalene-1,3-disulfonic…

3-Cyano-5-methylpyridine (3-Cyano-5-picoline)

Product Name : 3-Cyano-5-methylpyridine (3-Cyano-5-picoline)Synonym : CAS: 42885-14-3Formula: C7H6N2Molecular Weight : 118.14Alternative CAS RN : –EC Number: 255-988-8MDL Number : MFCD00673151Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

4-Methylumbelliferyl 6-Thio-palmitate-β-D-glucopyranoside

Product Name : 4-Methylumbelliferyl 6-Thio-palmitate-β-D-glucopyranosideSynonym : CAS: 229644-17-1Formula: Molecular Weight : 592.78Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…

7-Benzyloxy-4-trifluoromethylcoumarin

Product Name : 7-Benzyloxy-4-trifluoromethylcoumarinSynonym : BFC; 7-benzyloxy-4-trifluoromethyl-coumarinCAS: 220001-53-6Formula: C17H11F3O3Molecular Weight : 320.26Alternative CAS RN : –EC Number: –MDL Number : MFCD01564466Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code :…

Carnosic acid

Product Name : Carnosic acidSynonym : CAS: 3650-09-7Formula: C20H28O4Molecular Weight : 332.43Alternative CAS RN : –EC Number: –MDL Number : MFCD02259459Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code :…

Phenoxyethanol, USP-NF grade

Product Name : Phenoxyethanol, USP-NF gradeSynonym : 2-Phenoxyethyl alcohol; Ethylene glycol, 2-monophenyl ether; 2-PhenoxyethanolCAS: 122-99-6Formula: C8H10O2Molecular Weight : 138.17Alternative CAS RN : –EC Number: 204-589-7MDL Number : MFCD00002857Storage Temperature :…

3-Hydroxypiperidine

Product Name : 3-HydroxypiperidineSynonym : CAS: 6859-99-0Formula: C5H11NOMolecular Weight : 101.15Alternative CAS RN : –EC Number: 229-957-4MDL Number : MFCD00014591Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293339994-Hydroxybenzenesulfonyl…

Xylazine

Product Name : XylazineSynonym : 2-(2,6-Dimethylphenylamino)-5,6-dihydro-4H-thiazine hydrochlorideCAS: 7361-61-7Formula: C12H16N2SMolecular Weight : 220.33Alternative CAS RN : –EC Number: 230-902-1MDL Number : MFCD00057908Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code :…

2-Amino-5-methylbenzenethiol

Product Name : 2-Amino-5-methylbenzenethiolSynonym : CAS: 23451-96-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –(4,5-Dimethoxy-2-nitrophenyl)methanol…

Decylamine

Product Name : DecylamineSynonym : CAS: 2016-57-1Formula: C10H23NMolecular Weight : 157.30Alternative CAS RN : –EC Number: 217-957-7MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292119992-(3-Butyn-1-yloxy)acetic…

(+)-10,2-Camphorsultam

Product Name : (+)-10,2-CamphorsultamSynonym : CAS: 108448-77-7Formula: C10H17NO2SMolecular Weight : 215.32Alternative CAS RN : –EC Number: –MDL Number : MFCD00151762Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Bis(2-(2-methoxyethoxy)ethyl)amine…

3-Trifluoromethylpyrazole

Product Name : 3-TrifluoromethylpyrazoleSynonym : CAS: 20154-03-4Formula: C4H3F3N2Molecular Weight : 136.08Alternative CAS RN : –EC Number: –MDL Number : MFCD00115018Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4-Bromo-3-hydroxypyridine…

ICI 204,448 hydrochloride

Product Name : ICI 204,448 hydrochlorideSynonym : (±)-1--3--2-butanol hydrochloride; R,S-methylamino]-2-(1-pyrrolidinyl)ethyl] phenoxy]-acetic acid hydrochloride; (RS)-methylamino]-2-(1-pyrrolidinyl)ethyl]phenoxy]acetic acid hydrochlorideCAS: 121264-04-8Formula: C23H26Cl2N2O4 · HClMolecular Weight : 501.83Alternative CAS RN : –EC Number: –MDL Number…

Astragaloside II

Product Name : Astragaloside IISynonym : CAS: 84676-89-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

2,5-Diaminobenzenesulfonic acid

Product Name : 2,5-Diaminobenzenesulfonic acidSynonym : CAS: 88-45-9Formula: C6H8N2O3SMolecular Weight : 188.20Alternative CAS RN : –EC Number: 201-832-9MDL Number : MFCD00007904Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

4-Chlorophenyl cyclopropyl ketone 98%

Product Name : 4-Chlorophenyl cyclopropyl ketone 98%Synonym : CAS: 6640-25-1Formula: C10H9ClOMolecular Weight : 180.63Alternative CAS RN : –EC Number: 229-655-2MDL Number : MFCD00001295Storage Temperature : –Shipping Temperature : –Harmonised Tariff…

3-Fluorobenzotrichloride

Product Name : 3-FluorobenzotrichlorideSynonym : CAS: 401-77-4Formula: C7H4Cl3FMolecular Weight : 213.47Alternative CAS RN : –EC Number: 206-931-0MDL Number : MFCD00042073Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1450754-37-6…

Bis-trifluoroacetoxyiodobenzene

Product Name : Bis-trifluoroacetoxyiodobenzeneSynonym : benzene; BTI; Iodobenzene I,I-bis(trifluoroacetate); PIFA; Iodosobenzene bis(trifluoroacetate)CAS: 2712-78-9Formula: C10H5F6IO4Molecular Weight : 430.04Alternative CAS RN : –EC Number: 220-308-0MDL Number : MFCD00009672Storage Temperature : +20°CShipping Temperature…

Iron(III) oxide, technical

Product Name : Iron(III) oxide, technicalSynonym : CAS: 1309-37-1Formula: Fe2O3Molecular Weight : 159.69Alternative CAS RN : –EC Number: 215-168-2MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…

Ase, TGFBR3 mRNA expression inversely correlated with MYCN mRNA expression (Figure

Ase, TGFBR3 mRNA expression inversely correlated with MYCN mRNA expression (Figure 2C). To investigate regardless of whether MYCN suppresses TRIII expression in NB cells, we applied complementary inducible and repressible…

Magnesium sulfate heptahydrate

Product Name : Magnesium sulfate heptahydrateSynonym : Magnesium sulphate heptahydrate; Epsom saltsCAS: 10034-99-8Formula: MgSO4 · 7H2OMolecular Weight : 246.48Alternative CAS RN : –EC Number: 231-298-2MDL Number : MFCD00149785Storage Temperature :…

Betamethasone 21-phosphate disodium

Product Name : Betamethasone 21-phosphate disodiumSynonym : 9-Fluoro-11β,17,21-trihydroxy-16β-methylpregna-1,4-diene-3,20-dione 21-(disodium phosphate)CAS: 151-73-5Formula: C22H28FNa2O8PMolecular Weight : 516.40Alternative CAS RN : –EC Number: 205-797-0MDL Number : MFCD00200361Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…

2-Cyano-5-methylpyridine (2-Cyano-5-picoline)

Product Name : 2-Cyano-5-methylpyridine (2-Cyano-5-picoline)Synonym : CAS: 1620-77-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

1,2,3,4-Tetrahydronaphthalene

Product Name : 1,2,3,4-TetrahydronaphthaleneSynonym : CAS: 119-64-2Formula: C10H12Molecular Weight : 132.21Alternative CAS RN : –EC Number: 204-340-2MDL Number : MFCD00001733Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29029000Cubane-1-carboxylic…

1,8-Naphthalenediol

Product Name : 1,8-NaphthalenediolSynonym : Naphthalene-1,8-diol; 1,8-DihydroxynaphthaleneCAS: 569-42-6Formula: C10H8O2Molecular Weight : 160.20Alternative CAS RN : –EC Number: –MDL Number : MFCD00042701Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…

Dehydroabietic acid

Product Name : Dehydroabietic acidSynonym : CAS: 1740-19-8Formula: C20H28O2Molecular Weight : 300.44Alternative CAS RN : –EC Number: 217-102-8MDL Number : MFCD09839012Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…

2-Nitro-1-naphthol

Product Name : 2-Nitro-1-naphtholSynonym : CAS: 607-24-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290899001450754-37-6…

Methyl a-L-rhamnopyranoside

Product Name : Methyl a-L-rhamnopyranosideSynonym : CAS: 14917-55-6Formula: C7H14O5Molecular Weight : 178.19Alternative CAS RN : –EC Number: 238-987-7MDL Number : MFCD00067654Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

4-Methylbenzotrifluoride

Product Name : 4-MethylbenzotrifluorideSynonym : CAS: 6140-17-6Formula: C8H7F3Molecular Weight : 160.14Alternative CAS RN : –EC Number: 228-124-2MDL Number : MFCD00075476Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –13-Bromotridec-1-ene…

CI-994

Product Name : CI-994Synonym : 4-Acetylamino-N-(2′-aminophenyl)benzamide; Acetyldinaline; Tacedinaline; CI−994CAS: 112522-64-2Formula: C15H15N3O2Molecular Weight : 269.30Alternative CAS RN : –EC Number: –MDL Number : MFCD00866266Storage Temperature : +20°CShipping Temperature : –Harmonised Tariff…

3-Methylindole (Skatole)

Product Name : 3-Methylindole (Skatole)Synonym : CAS: 83-34-1Formula: C9H9NMolecular Weight : 131.18Alternative CAS RN : –EC Number: 201-471-7MDL Number : MFCD00005627Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…

1-Bromo-3,4-difluorobenzene

Product Name : 1-Bromo-3,4-difluorobenzeneSynonym : CAS: 348-61-8Formula: C6H3BrF2Molecular Weight : 192.99Alternative CAS RN : –EC Number: 206-481-5MDL Number : MFCD00000304Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1350518-27-2…

Dicyclopentadiene

Product Name : DicyclopentadieneSynonym : CAS: 77-73-6Formula: C10H12Molecular Weight : 132.21Alternative CAS RN : –EC Number: 201-052-9MDL Number : MFCD00078246Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29021900Buy674287-63-9…

(1S,2S)-(+)-2-Amino-1-phenyl-1,3-propanediol

Product Name : (1S,2S)-(+)-2-Amino-1-phenyl-1,3-propanediolSynonym : CAS: 28143-91-1Formula: C9H13NO2Molecular Weight : 167.21Alternative CAS RN : –EC Number: 248-867-6MDL Number : MFCD00004503Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29221985900(+)-Sparteine…

4-Chloro-2-fluorobenzaldehyde

Product Name : 4-Chloro-2-fluorobenzaldehydeSynonym : CAS: 61072-56-8Formula: C7H4ClFOMolecular Weight : 158.56Alternative CAS RN : –EC Number: –MDL Number : MFCD00143282Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1,12-Dibromododecane…

2-Nitro-4-trifluoromethylbenzonitrile

Product Name : 2-Nitro-4-trifluoromethylbenzonitrileSynonym : CAS: 778-94-9Formula: C8H3F3N2O2Molecular Weight : 216.12Alternative CAS RN : –EC Number: 212-298-1MDL Number : MFCD00014684Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy8-Hydroxyjulolidine…

1,3-Diethylurea