Arated having a gradient at 1 ml min1: 010 min 70:30 Solvent A:Solvent
Arated using a gradient at 1 ml min1: 010 min 70:30 Solvent A:Solvent B, 100 min gradient to 100 Solvent B, 208 min one hundred Solvent B, 2830 min gradient…
Arated using a gradient at 1 ml min1: 010 min 70:30 Solvent A:Solvent B, 100 min gradient to 100 Solvent B, 208 min one hundred Solvent B, 2830 min gradient…
Ell line found to become BRMpositive. As BAF155 is sensitive to degradation, the presence of BAF155 expression in all cell lines such as the constructive manage, H460, demonstrates that degradation…
Sely, experiments investigating intracellular bacterial survival kinetics, as well as those investigating osteoblast mortality utilizing two representative isolates of ST80IV (HT20020209) and ST8EMRSA2IV (HT20040117), were conducted applying 3 consecutive passages…
Ipt; offered in PMC 2014 June 01.Chlebowski et al.PageStudy strengths contain the size of your significant properly characterized, ethnically diverse study population, serial joint symptom determination within the context of…
S combined around the recovery of spermatogenesis right after radiation. Preirradiation testicular biopsies from both testes, amounting to five from the testis and an typical of 2.two g tissue, were…
NOVA and Tukey’s post hoc test.considerably elevated than that in CONT and R1 groups ( 0.05). The weights of cecal tissue and content material in FOS and GM groups were…
D slippage within repetitive DNA sequence components modifications the size on the mononucleotide or dinucleotide repeats (microsatellites) which can be scattered all through the genome. Mismatchrepair deficiency may also be…
Entative experiment out of two is shown. Entire L. monocytogenes are labeled green with FITC and RNA is visible as red fluorescence (Alexa594), nuclei are stained by DAPI (blue). doi:10.1371/journal.pone.0062872.gpathway…
Ring the transcription price per gene and changing the fraction of 200 rRNA genes that happen to be within the active state. Almost 50 of rDNA repeats are present as…
5. The WHO score is as follows: grade 0 = regular, no mucositis; grade 1 = soreness and erythema; grade2 = erythema, ulceration, can consume solids; grade three = ulcers…
S were harvested 48 h following transfection to analyze BRUCE expression. Western blotting. To detect the BRUCE protein, the cell lysate in radioimmunoprecipitation assay (RIPA) buffer (50 g) was mixed…
Cular orbitals (MOs) for -P-SCl result from electrophilic addition of Cl atom to the sulfur in DMP calculated applying the B3LYP/6-31G* technique are shown in Figure six. From Figure six,…
Es (Falcon, Becton Dickinson, Heidelberg, Germany) at 2?06 cells per dish. The cells have been cultured in RPMI1640 total medium (Gibco-BRL, Regenstein, Germany) like penicillin (100 U/ml, Sigma, St. Louis,…
Ation assay. H9 cells were infected with a Zap-70 vaccinia virus either alone or with each other using the Nef-Flag virus, followed by treatment with 10 M DQBS for 4…
Nal excellent control exactly where all of the following parameters were upheld: clear definition of objectives, procedures, standards and criteria for the tolerance limits, corrective actions and registration of your…
Ients. In contrast, their frequencies in strains isolated from ART-treated patients were substantially improved, suggesting their precise association with ART remedy. Since the ART regimen of those individuals contained two…
Aki et al., 1999) and improves microvascular autoregulation in chronic kidney disease (Lin et al., 1998). Additional research are going to be required to ascertain irrespective of whether IGF-1 remedy…
Ees with studies by Wooley et al, who reported the hydrolysis of micelle cores by proteinase K in crosslinked micelles. To attain a solid formulation of dC3 micelles, we investigated…
Ing the epithelial cycle of spermatogenesis. As an example, at stage VIII on the epithelial cycle, remodeling with the BTB is necessary to accommodate the transport of preleptotene spermatocytes which…
Ne checkpoint | Zhu et al.Figure 3. Expression of a putative ligand for CD112R. (A) Immune cells in human blood and monocyte-derived DCs have been stained with manage (FLAG-Fc; red)…
OL.(ii) SF-Quality of life outcomes have been also assessed in patients switched to lurasidone working with the SF-12 survey, a multipurpose generic measure of overall health status . The SF-12…
B, Angermeyer MC, Leese M, Thornicroft G, Schene A, Kikkert M, Burti L, Tansella M, Becker T: Course of adherence to medication and high-quality of life in individuals with schizophrenia.…
Possesses form II cells, or sustentacular cells and it has been proposed that they are adult neural stem cells sustaining neurogenesis in vivo in response to physiological stimuli, like chronic…
A substantially larger incidence of endometrial and ovarian cancer in patients treated with adjuvant hormonal therapy (five.two ) in comparison with individuals not administered hormonal therapy (1.8 , P= 0.002).…
Et al., 2001; Rodriguez-Del Rio et al., 2011) and detailed in Supporting Info. Endosomal fractions were made use of as manage vesicles to standardize basal levels for protein composition analysis…
Beneficial commentsand discussions; A. Lenuweit, S. Opitz, H. Wickborn for great technical assistance. J.K., R.F. and M.H. created experiments. J.K., R.F. and M.H. performed experiments and analysed data. J.K., R.F.,…
Dent Hif2 transactivation of gene expression has not been reported in the scientific literature (to our know-how), suggesting that that is a novel regulatory mechanism. Hif2 is preferentially stabilized in…
Oduct of 461 base pairs (bp) encompassing exon 13 of KCNQ3 was amplified working with primers KCNQ3_13a: TATTCCAAACCCTTATCTCAT and KCNQ3_13b: AAACAGGTGGGG CTATTA. PCR fragments amplified from the WT allele had…
Evation of cytoplasmic calcium level (Figure four(d)). The median fluorescence intensity of calcium probe escalated within a dose-dependent manner and reached as higher as 3? times more than vehicle handle…
Ut below a protocol authorized by the Institutional Animal Care and Use Committee at Baylor College of Medicine and were in accordance using the National Institutes of Health suggestions for…
Much more probably to possess 2 SLC26A4 mutant alleles than those with nonsyndromic EVA . In addition, the number of SLC26A4 mutant alleles is substantially correlated using the severity of…
As also demonstrated the antiCaspase-9 and -3 are Essential to Dasatinib/VPA-induced Apoptosis Pathway in HL60 CellsCaspase-9, an initiator caspase, forms a complex by binding to apoptotic protease-activating factor-1 (Apaf-1), and…
Ally improved ERK1/2 phosphorylation and c-Fos expression in LPS-challenged cardiomyocytes, which were prevented by prazosin. These findings recommend that NE enhanced ERK1/2 phosphorylation and c-Fos expression by means of activating…
Ressing osteoclastogenesis. Nat Med. 2009;15(9):1066?071. 13. Karin M, Greten FR. NF-B: linking inflammation and immunity to cancer improvement and progression. Nat Rev Immunol. 2005;five(10):749?59. 14. Courtois G, Gilmore TD. Mutations…
Fect of other branched-chain amino acids on AHAS, as Barton and Slaughter (1992) and Magee and de Robichon-Szulmajster (1968) observed that leucine also had an inhibiting effect around the AHAS…
Product Name : p47-phox Recombinant Mouse Monoclonal Antibody Predicted band size : 45 kDaObserved band size : 45 kDaSynonyms: 47 kDa autosomal chronic granulomatous disease protein antibody 47 kDa neutrophil…
?.22, p = 0.006). Of these individuals, 27/40 in the albumin group and 10/16 in the saline group had ICP measurements 20 mm Hg (RR 1.08, 95 CI 0.70?.67, p…
Or OTCH2-NICD antibodies. As reported previously (38), beneath basal circumstances, RELB and p52 were expressed primarily inside the cytoplasm and NICD mainly within the nucleus. Immediately after TNF therapy, colocalization…
B), which suggests that thapsigargin could be utilised as a brand new NOTCH inhibitor in our model. To investigate whether thapsigargin has a bone-anabolic impact in TNF-Tg mice comparable to…
, Ashland, OR). Confocal microscopy for EBV p52, HHV-6A gp116, HHV-6B gp116, HHV-7 KR4, and the KSHV late gene ORFK8.1. Detection of viral protein expression was performed by immunofluorescence applying…
Product Name : c-Fos Recombinant Rabbit Monoclonal Antibody Predicted band size : 41 kDaObserved band size : 41-55 kDaSynonyms: Activator protein 1 antibody AP 1 antibody C FOS antibody Cellular…
Ithin the past 20 years, this basic view with the lipid droplet (LD) has been refined, and several molecular particulars had been added, as not too long ago reviewed (1?).…
Ifferential effects of cocaine-like and atypical DAT inhibitors is the fact that atypical inhibitors engender handful of cocaine-like behavioral responses, not simply because of their special DAT binding profile, but…
Product Name : ZNF93 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: FLJ12488 HPF34 HTF34 TF34 Zinc finger protein 505 Zinc finger protein 93 (HTF34) Zinc finger…
76) and P. falciparum multidrug-resistant gene (pfmdr1) codon86 mutant allele (Y86) inside the country . Prevalence of pfcrt T76 mutation has been related to clinical chloroquine resistance and represents a…
Product Name : ZNF131 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: pHZ 10 pHZ10 Zinc finger protein 131 ZN131_HUMAN ZNF 131 Znf131.Function : May be involved…
Ystem (T3SS), and form IV pili (9). RsmA negatively controls variables linked with chronic colonizationpnas.org/cgi/doi/10.1073/pnas.Thomologs (RsmA and RsmE) (13, 14), only RsmA had been identified within the opportunistic human pathogen…
Tion (0.08 Hz). C, nipecotic acid (5 mM) decreased the eEPSC amplitude to about ten of control (n = 9). D, nipecotic acid (five mM) induced a frequency-dependent facilitation through…
Product Name : VPS72 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: CFL1 antibody HGNC11644 antibody Protein YL-1 antibody Swc2 antibody TCFL1 antibody Transcription factor like 1…
Product Name : Vimentin Mouse Monoclonal Antibody Predicted band size : 54 kDaObserved band size : 54 kDaSynonyms: CTRCT30 antibody Epididymis luminal protein 113 antibody FLJ36605 antibody HEL113 antibody VIM…
D around the observations from all therapies, PSU and consequently damaging PE in our study are most likely attributed for the particularly low sediment organic C (OC) content at all…
Les or oil bodies, serve as a storage compartment for nonpolar lipids. In S. cerevisiae, triacylglycerols (TG) and steryl esters (SE) will be the two big classes of nonpolar lipids.…
In the amount of LD in dga1 lro1 is markedly reduced than in wild type yeast cells (36).3 Therefore, the low variety of LD within this mutant and its altered…
Product Name : USP36 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Deubiquitinating enzyme 1 antibody Deubiquitinating enzyme 36 antibody DUB1 antibody FLJ12851 antibody KIAA1453 antibody Ubiquitin…
Ma Thyroid cancer Melanoma Non-small cell lung cancerTyrosine kinase inhibitors FDA-approved Imatinib, 2001 GleevecPhC, cKIT, CDGefitinib, 2003 Erlotinib, 2004 Sorafenib, 2005 Dasatinib, 2006 Sunitinib,Iressa Tarceva Nexavar Sprycel SutentEGFR EGFR VEGFR,…
Ing collect the WAXS information. Raloxifene was kindly supplied by Eli Lilly (Indianapolis, IN, USA) below a Material Transfer Agreement to D.B.B. Eli Lilly was not involved within the study…
Quantification possible of immuno-PET were also assessed . PET quantification of blood-pool activity within the left ventricle was in fantastic agreement with sampled blood activity, except for heavy weight patients…
Product Name : Transferrin Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Apotransferrin antibody Beta 1 metal binding globulin antibody Beta-1 metal-binding globulin antibody DKFZp781D0156 antibody PRO1400…
Cells and U87-MG human glioblastoma multiforme cells. On the other hand, the antitumor effects of hTERTC27 in hepatoma and its underlying mechanisms are unclear. Inside the existing study, the therapeutic…
Product Name : Terminal uridylyltransferase 4 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: DKFZp779C1943 antibody EC 2.7.7.52 antibody FLJ42878 antibody KIAA0191 antibody PAP associated domain containing…
. Lung cancer is largely attributable to environmental carcinogens. By far, tobacco smoke would be the most significant environmental carcinogen leading to lung cancer. These days, the epidemiology of lung…
S–All chemicals were obtained from Fisher unless noted below. Cloning, Protein Expression, and Purification–Full-length NWMN2274 was PCR-amplified from S. aureus strain Newman chromosomal DNA with forward primer (5 -AGC GGC…
Product Name : TREX1 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: 3′ 5′ exonuclease TREX1 antibody 3′ repair exonuclease 1 antibody AGS1 antibody AGS5…
T can be viewed like a modified Newton algorithm and that equivalent modifications had been applied efficiently elsewhere. On the other hand, it truly is clear from the type of…
Product Name : TRAM2 Recombinant Rabbit Monoclonal AntibodyPredicted band size : 43 kDaObserved band size : 43 kDaSynonyms: Translocating chain-associated membrane protein 2 TRAM2 KIAA0057Function : Translocating chain-associated membrane protein…
Product Name : TPC2L Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Trafficking protein particle complex subunit 2-like proteinTRAPPC2L antibody Trafficking protein particle complex subunit 2-like proteinHSPC126…
N). When the cutoff criteria set bythis review have been applied to the IFN- assay, 79 (30.4 ) of your 260 SIDT-negative cattle from herds with latest BTB outbreaks and…
In liquid smoke couldn’t be eradicated, even so, by distinctive fractionation approaches like filtration, adsorption on charcoal or protein, chloroform extraction (the exercise was retained inside the aqueous fraction), desiccation…
Product Name : THYN1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: HSPC144 antibody MDS012 antibody MGC12187 antibody MY105 antibody THY28 antibody THY28KD antibody thymocyte nuclear protein…
Product Name : TCP1 alpha/CCTA Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: AI528772 antibody c-cpn antibody CCT alpha antibody CCT antibody CCT-alpha antibody CCT1…
Product Name : TBP-1 Rabbit Polyclonal AntibodyPredicted band size : 49 kDaObserved band size : 49 kDaSynonyms: 26S protease regulatory subunit 6A antibody 26S proteasome AAA-ATPase subunit RPT5 antibody Human…
Product Name : Synaptopodin Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: KIAA1029 antibody Synaptopodin antibody SYNPO antibody SYNPO_HUMAN antibodyFunction : Antibody Type: Rabbit Polyclonal AntibodyImmunogen :…
Arkers for neurons and astrocytes, respectively. Each CD11b and Iba1 had been utilised as markers for microglia. For immunohistochemistry, mice had been perfused with phosphate-buffered saline, pH 7.5 (PBS) followed…
Which can be produced (by partial fermentation) mostly in southern China. Green and black teas are processed differently for the duration of manufacturing. To generate green tea, freshly harvested leaves…
Product Name : Skp1 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: Cyclin A/CDK2 associated p19 antibody Cyclin A/CDK2 associated protein p19 antibody Cyclin-A/CDK2-associated protein…
Product Name : Smad1 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: BSP-1 antibody BSP1 antibody HsMAD1 antibody JV4-1 antibody JV41 antibody MAD homolog 1…
Product Name : Semaphorin 3E Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Coll 5 antibody Coll5 antibody KIAA0331 antibody M sema H antibody M SEMAH antibody…
Product Name : SV2C Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Synaptic vesicle protein 2c antibodyFunction : Plays a role in the control of regulated secretion…
Product Name : SVOP Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: SVOP antibody Synaptic vesicle 2-related protein antibody SV2-related protein antibodyFunction : Belongs to the major…
Product Name : STING Recombinant Rabbit Monoclonal Antibody Predicted band size : 42 kDaObserved band size : 37 kDaSynonyms: endoplasmic reticulum IFN stimulator antibody Endoplasmic reticulum interferon stimulator antibody ERIS…
Product Name : SRF Recombinant Rabbit Monoclonal Antibody Predicted band size : 52 kDaObserved band size : 67 kDaSynonyms: c fos serum response element binding factor antibody c fos serum…
Ecan, cisplatin, and bevacizumab in patients with metastatic gastric or gastroesophageal junction adenocarcinoma. J Clin Oncol 2006, 24(33):5201?206. 44. Shah MA, Jhawer M, Ilson DH, Lefkowitz RA, Robinson E, Capanu…
Product Name : SPF45 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: 45 kDa-splicing factor antibody RBM 17 antibody Rbm17 antibody RNA binding motif protein 17 antibody…
Product Name : iFluorâ„¢ 488 Conjugated SOX2 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: ANOP3 antibody cb236 antibody Delta EF2a antibody lcc antibody MCOPS3…
Acid methyl ester showing M+ ions are shown. m/z 242 represents monoisotopic mass of myristylmethylester, whereas m/z 256 represents totally labeled species. FA, fatty acid; LPC, lysophosphatidylcholines; PG, phosphatidylglycerols; PS,…
Product Name : SMG7 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: breast cancer-associated antigen SGA-56M antibody C1orf16 antibody EST1 like protein C antibody EST1 telomerase component…
He reports showed that most mutations originate from the parental cell line (Gore et al., 2011; Cheng et al., 2012; Ruiz et al., 2013). As with the origin of CNVs,…
Is of p53 and its targets PUMA, Bax, and p21 in fl/fl or / MEFs treated overnight with 20 M etoposide. **P 0.01, n = three, mean ?SEM, Student’s t…
Product Name : SHP-2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: BPTP3 antibody CFC antibody JMML antibody METCDS antibody MGC14433 antibody NS1 antibody OTTHUMP00000166107 antibody OTTHUMP00000166108…
Antigen stimulation, interacts with Fc RI and is needed for allergic inflammation both in vitro and in vivo (23). Though we reported the function of HDAC3 in allergic skin inflammatory…
Ns of SETBP1 appear to be gain-of-function, are linked with myeloid leukemic transformation and convey a poor prognosis in myelodysplastic syndromes (MDS) and CMML. In the course of the past…
Product Name : SAP97 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Discs large homolog 1 antibody discs large, Drosophila, homolog of, 1 antibody discs, large homolog…
Performed employing the Student t-test.Mapk8ip1-silenced stressed cells compared together with the adverse handle, whilst Gck, Pdx-1, Insr, Vamp2, Snap25, Syt5, Cacnb, Mafa, and NeuroD remained unaffected (Figure 6A). These findings…
Correspondence ought to be addressed; E-Mail: [email protected]; Tel.: +852-391-792-34; Fax: +852-285-597-30. External Editor: Rudiger Hardeland Received: 15 July 2014; in revised type: 26 September 2014 / Accepted: two October 2014…
Dical oncologists, other internists (OR=1.38; 95 CI, 1.23?1.54) and hospitalists (OR=1.61; 95 CI, 1.32?.96) additional normally employed vancomycin.JAMA Intern Med. Author manuscript; available in PMC 2013 June 06.Wright et al.PageDespite…
Product Name : Rap 2C Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: 2010200P20Rik antibody AI194294 antibody AL022976 antibody BOS_25229 antibody DKFZp313B211 antibody MGC143331 antibody OTTHUMP00000024037 antibody…
0.225 (0.127) for isoleucine, 0.220 (0.137) for phenylanaline, and 0.170 (0.114) for tyrosine.Table 4 DM-AA score and danger of moderate-to-severe atherosclerosis at baseline examination ……………………………………………………………………..DM-AA score as a continuous variable…
GAG content was decreased with decellularization, in particular with trypsin, and also the GAG content was closest to that in the control with Triton X-100. The preservation of collagen and…
Product Name : RRAS2 Rabbit Polyclonal AntibodyPredicted band size : 23 kDaObserved band size : 23 kDaSynonyms: C86394 antibody Oncogene RRAS2 antibody Oncogene TC21 antibody Ras like protein TC21 antibody…
Ytes have been treated with car, bortezomib, or bortezomib plus Y27632. (B) Western blot for phospho-MLC. (C) Representative confocal photos of human megakaryocytes stained with WGA (red) and phalloidin (green).…
Ding and management on the database. JP had the duty of statistical analyses and made suggestions on data presentation. KJP analysed and interpreted the data on inflammatory variables, and MS…
Product Name : RNF3 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: DONG1 antibody PCGF3 antibody PCGF3_HUMAN antibody Polycomb group ring finger 3 antibody Polycomb group RING…
Tress. Yet, that is relevant for the reason that mild vs. serious pressure may possibly qualitatively alter plant response, either leading to strain priming and adaptation or to hypersensitive response…
T control DNA binding affinity, i.e., the recognition helices and -wing, move in a concerted style (Fig. 6a). The allosteric “hot-spot” identified here centered on V66 and L68 then basically…
Unnatural Amino Acid Side Chain on the Conformational Dynamics of Peptides. Chem.Phys. Chem. 2012; 13:1522?534. (41). Drozdov AN, Grossfield A, Pappu RV. Role of Solvent in Determining Conformational Preferences of…
Product Name : RBP4 Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: OTTHUMP00000020114 antibody OTTHUMP00000020115 antibody OTTHUMP00000020116 antibody Plasma retinol binding protein 4 antibody Plasma…
Product Name : RAB1A Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: GTP binding protein RAB 1A antibody mKIAA3012 antibody RAB 1 antibody Rab 1A antibody RAB1…
Product Name : Phospho-eNOS (S1177) Recombinant Rabbit Monoclonal Antibody Predicted band size : 133 kDaObserved band size : 160 kDaSynonyms: cNOS antibody Constitutive NOS antibody EC NOS antibody EC-NOS antibody…
Product Name : Phospho-DNA PKcs (S2056) Recombinant Rabbit Monoclonal Antibody Predicted band size : 469 kDaObserved band size : 469 kDaSynonyms: DNA dependent protein kinase catalytic subunit antibody DNA PK…
Product Name : Periphilin 1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Gastric cancer antigen Ga50 antibody Periphilin 1 antibody Periphilin-1 antibody PPHLN_HUMAN antibody PPHLN1 antibodyFunction…
Product Name : PTPRG Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Receptor-type tyrosine-protein phosphatase gamma PTPRG antibody Receptor-type tyrosine-protein phosphatase gamma PTPG antibodyFunction : The protein…
Product Name : PSMA Mouse Monoclonal Antibody Predicted band size : 84 kDaObserved band size : 100/200 kDaSynonyms: Cell growth inhibiting protein 27 antibody Cell growth-inhibiting gene 27 protein antibody…
Product Name : PPP1R3A Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: PPP1R3A antibody PP1G antibody Protein phosphatase 1 regulatory subunit 3A antibody Protein phosphatase 1 glycogen-associated…
Product Name : POMC Recombinant Mouse Monoclonal Antibody Predicted band size : Observed band size : Synonyms: ACTH antibody Adrenocorticotropic hormone antibody Adrenocorticotropin antibody alpha melanocyte stimulating hormone antibody Alpha…
Product Name : PKN1 Mouse Monoclonal Antibody Predicted band size : Observed band size : Synonyms: DBK antibody PAK 1 antibody PAK-1 antibody PAK1 antibody PKC1 antibody PKN ALPHA antibody…
Product Name : PHX2B Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: NBLST2 antibody NBPhox antibody Neuroblastoma paired type homeobox protein antibody Neuroblastoma Phox antibody Paired like…
Product Name : PC-PLD1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Choline phosphatase 1 antibody hPLD1 antibody Phosphatidylcholine-hydrolyzing phospholipase D1 antibody Phospholipase D1 antibody PLD 1…
Product Name : PAR4 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: 2310001G03Rik antibody PAR 4 antibody PAR-4 antibody Pawr antibody PAWR_HUMAN antibody PRKC Apoptosis WT1 Regulator…
Product Name : P2X6 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: ATP receptor antibody P2RX6 antibody P2RX6_HUMAN antibody P2RXL1 antibody P2X purinoceptor 6 antibody P2X6 antibody…
Product Name : P2RY1 Mouse Monoclonal Antibody Predicted band size : Observed band size : Synonyms: ATP receptor antibody P2 purinoceptor subtype Y1 antibody P2RY1 antibody P2RY1_HUMAN antibody P2Y purinoceptor…
Product Name : Olfactory receptor 6B2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: OR6B2 antibody OR6B2P antibody Olfactory receptor 6B2 antibody Olfactory receptor OR2-1 antibodyFunction :…
Product Name : Olfactory receptor 2AG1/2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: OR2AG2 antibody OR2AG2P antibody Olfactory receptor 2AG2 antibody OR2AG1 antibody OR2AG3 antibody Olfactory…
Product Name : Olfactory receptor 13H1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Olfactory receptor 13H1 OR13H1 antibodyFunction : Olfactory receptors interact with odorant molecules in…
Product Name : 5-Chloroethyl-6-chloro-1,3-dihydro-2H-indol-2-oneSynonym : CAS: 118289-55-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy4-Bromobenzoic…
Product Name : 1-Hexanesulfonic acid sodium salt monohydrate, HPLC gradeSynonym : Sodium 1-hexanesulfonate monohydrateCAS: 207300-91-2Formula: C6H13NaO3S · H2OMolecular Weight : 206.24Alternative CAS RN : 2832-45-3EC Number: 220-601-3MDL Number : MFCD00149549Storage…
Product Name : 3-TrifluoromethylbenzaldehydeSynonym : CAS: 454-89-7Formula: C8H5F3OMolecular Weight : 174.12Alternative CAS RN : –EC Number: 207-228-1MDL Number : MFCD00003373Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29130000853-68-9…
Product Name : 2-Methyl-1-butanolSynonym : sec-Butyl carbinol; (±)-2-Methyl-1-butanol; (+/-)-2-Methyl-1-butanol; Active amyl alcohol; DL-2-Methyl-1-butanolCAS: 137-32-6Formula: C5H12OMolecular Weight : 88.15Alternative CAS RN : –EC Number: 205-289-9MDL Number : MFCD00004743Storage Temperature : +20°CShipping…
Product Name : 5-(2-Fluorophenyl)tetrazoleSynonym : CAS: 50907-31-8Formula: C7H4Cl2N4Molecular Weight : 215.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00808036Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4-Methylbenzenesulfonyl…
Product Name : N6-(2-Deoxy-D-glucos-2-yl)-L-lysineSynonym : CAS: 112793-01-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1623432-63-2…
Product Name : 4-(Hydroxymethyl)piperidineSynonym : CAS: 6457-49-4Formula: C6H13NOMolecular Weight : 115.18Alternative CAS RN : –EC Number: –MDL Number : MFCD00174228Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29333999901,3-Benzoxazol-5-amine…
Product Name : Mercaptosuccinic acidSynonym : Thiomalic acid; 2-Sulphanylbutane-1,4-dioic acidCAS: 70-49-5Formula: C4H6O4SMolecular Weight : 150.15Alternative CAS RN : –EC Number: 200-736-4MDL Number : MFCD00004860Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 5-Hydroxy-1-tetraloneSynonym : CAS: 28315-93-7Formula: C10H10O2Molecular Weight : 162.19Alternative CAS RN : –EC Number: 248-958-0MDL Number : MFCD00001693Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 2914500025952-53-8…
Product Name : Copper(ll) dioctadecanoateSynonym : Copper octadecanoate; Octadecanoic acid, copper(2+) salt (2:1); AI3-00903; Cupric stearate; Copperbis(octadecanoate); Copper dioctadecanoate; Octadecanoic acid copper(2+) saltCAS: 660-60-6Formula: C36H70CuO4Molecular Weight : 630.48Alternative CAS RN…
Product Name : 1-NaphthylmethylamineSynonym : 1-(Aminomethyl)naphthalene; 1-NaphthalenemethylamineCAS: 118-31-0Formula: C11H11NMolecular Weight : 157.22Alternative CAS RN : –EC Number: 204-244-0MDL Number : MFCD00004048Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Amino-2-chloropyridineSynonym : CAS: 5350-93-6Formula: C5H5ClN2Molecular Weight : 128.56Alternative CAS RN : –EC Number: 226-322-3MDL Number : MFCD00006243Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999Formula…
Product Name : 3-Aminophenylboronic acid monohydrateSynonym : CAS: 206658-89-1Formula: C6H8BNO2H2OMolecular Weight : 154.96Alternative CAS RN : –EC Number: 250-189-0MDL Number : MFCD00149554Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : (-)-alpha-TerpineolSynonym : (S)-p-Menth-1-en-8-ol; (S)-2-(4-Methyl-3-cyclohexenyl)-2-propanol; α-TerpineolCAS: 10482-56-1Formula: C10H18OMolecular Weight : 154.25Alternative CAS RN : –EC Number: 202-680-6MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 4-BromobenzaldehydeSynonym : CAS: 1122-91-4Formula: C7H5BrOMolecular Weight : 185.03Alternative CAS RN : –EC Number: 214-365-0MDL Number : MFCD00003377Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 291300004-(6-Bromopyridin-3-yl)morpholine…
Product Name : 3-Chloro-4-fluoropyridineSynonym : CAS: 883107-69-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1203499-17-5…
Product Name : Baicalin 7-b-D-glucuronideSynonym : Baicalein 7-O-β-D-glucuronide; Baicalein 7-β-D-glucopyranosiduronate; 5,6-Dihydroxy-4-oxo-2-phenyl-4H-1-benzopyran-7-yl-β-D-glucopyranosiduronic acid; Baicalein 7-O-β-D-glucuronide; 5,6-Dihydroxy-4-oxygen-2-phenyl-4H-1-benzopyran-7-beta-D-glucuronide; Baicalin; 5,6-Dihydroxy-4-oxo-2-phenyl-4H-1-benzopyran-7-yl β-D-glucopyranosiduronic acidCAS: 21967-41-9Formula: C21H18O11Molecular Weight : 446.36Alternative CAS RN : –EC Number: –MDL…
Product Name : 6-Methoxy-2-tetraloneSynonym : CAS: 2672-22-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyLumisterol…
Product Name : 2-Fluoro-5-trifluoromethylbenzonitrileSynonym : CAS: 4088-84-0Formula: C8H3F4NMolecular Weight : 189.11Alternative CAS RN : –EC Number: –MDL Number : MFCD00061280Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –(S)-2-Methoxypropan-1-ol…
Product Name : 3-Fluorocinnamic acidSynonym : CAS: 458-46-8Formula: C9H7FO2Molecular Weight : 166.15Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Phorbol 12-myristate 13-acetateSynonym : 12-O-Tetradecanoylphorbol 13-acetate; 4β,9α,12β,13α,20-Pentahydroxytiglia-1,6-dien-3-one 12-tetradecanoate 13-acetate; PMA; TPACAS: 16561-29-8Formula: C36H56O8Molecular Weight : 616.83Alternative CAS RN : –EC Number: –MDL Number : MFCD00036736Storage Temperature :…
Product Name : 1,5-Diazabicyclo(4.3.0)non-5-eneSynonym : DBNCAS: 3001-72-7Formula: C7H12N2Molecular Weight : 124.19Alternative CAS RN : –EC Number: 221-087-3MDL Number : MFCD00005554Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293359951217725-33-1…
Product Name : Benzimidazole-2-boronic acidSynonym : CAS: 475102-13-7Formula: C13H15BBrNO4Molecular Weight : 339.98Alternative CAS RN : –EC Number: –MDL Number : MFCD03701683Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-(Propoxycarbonyl)phenylboronic acidSynonym : CAS: 91062-38-3Formula: C10H13BO4Molecular Weight : 208.02Alternative CAS RN : –EC Number: –MDL Number : MFCD06659852Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,2-DimethylcyclopentanoneSynonym : CAS: 4541-32-6Formula: C7H12OMolecular Weight : 112.17Alternative CAS RN : –EC Number: –MDL Number : MFCD00049164Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code : 2914290090Formula…
Product Name : 5-Cyanothiophene-2-boronic acidSynonym : CAS: 305832-67-1Formula: C5H4BNO2SMolecular Weight : 152.97Alternative CAS RN : –EC Number: –MDL Number : MFCD02094029Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-(5-Phenyl-2-pyridyl)-5-phenyl-1,2,4-triazineSynonym : CAS: 108775-05-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyRibavirin…
Product Name : TepraloxydimSynonym : trans-2--3-hydroxy-5-(tetrahydro-2H-pyran-4-yl)-2-cyclohexen-1-oneCAS: 149979-41-9Formula: C17H24ClNO4Molecular Weight : 341.83Alternative CAS RN : –EC Number: –MDL Number : MFCD03792787Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293299003,5-Dibromo-1H-pyrazole-4-carbonitrile…
Product Name : 2-Cyanophenylboronic acidSynonym : CAS: 138642-62-3Formula: C7H6BNO2Molecular Weight : 146.94Alternative CAS RN : –EC Number: –MDL Number : MFCD01632208Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Methyl β-L-daunosaminide hydrochlorideSynonym : Daunosamine β-methyl glycosideCAS: 115388-97-1Formula: C7H15NO3 · HClMolecular Weight : 197.66Alternative CAS RN : –EC Number: –MDL Number : MFCD00270034Storage Temperature : –Shipping Temperature…
Product Name : 8-Hydroxyquinoline-2-sulfonic acid monohydrateSynonym : CAS: 20946-17-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : Leupeptin trifluoroacetate saltSynonym : Acetyl-Leu-Leu-Arg-al trifluoroacetate saltCAS: 147385-61-3Formula: C20H38N6O4 · xC2HF3O2Molecular Weight : 426.55 (free base bAlternative CAS RN : –EC Number: –MDL Number : MFCD00133458Storage Temperature…
Product Name : 5-Fluoro-2-trifluoromethylphenylboronic acidSynonym : CAS: 928053-97-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : EM20-25Synonym : 5-(6-Chloro-2,4-dioxo-1,3,4,10-tetrahydro-2H-9-oxa-1,3-diaza-anthracen-10-yl)-pyrimidine-2,4,6-trioneCAS: 141266-44-6Formula: C15H9ClN4O6Molecular Weight : 376.71Alternative CAS RN : –EC Number: –MDL Number : MFCD00624842Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –886593-45-9…
Product Name : 3-Chloro-2-fluorobenzaldehydeSynonym : CAS: 85070-48-0Formula: C7H4ClFOMolecular Weight : 158.56Alternative CAS RN : –EC Number: –MDL Number : MFCD01631571Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy1-Boc-3-Bromopiperidine…
Product Name : 5-Bromoindole-2-carboxylic acid ethyl esterSynonym : CAS: 16732-70-0Formula: C11H10BrNO2Molecular Weight : 268.11Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 3,5-Dimethylphenylboronic acidSynonym : CAS: 172975-69-8Formula: C8H11BO2Molecular Weight : 149.99Alternative CAS RN : –EC Number: –MDL Number : MFCD00185689Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Berberine hydrochlorideSynonym : Natural Yellow 18; Berberine chloride form; Berberine chloride hydrate; Natural yellow 18 hydrateCAS: 633-65-8Formula: C20H18ClNO4Molecular Weight : 371.82Alternative CAS RN : 2086-83-1, 141433-60-5EC Number:…
Product Name : Methyl 3-Acetamido-4,6-O-benzylidene-2,3-dideoxy-α-D-arabino-hexopyranosideSynonym : CAS: 4115-63-3Formula: Molecular Weight : 307.34Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : BenzotriazoleSynonym : 1,2,3-Benzotriazole; 1H-Benzotriazole ; AzimidobenzeneCAS: 95-14-7Formula: C6H5N3Molecular Weight : 119.13Alternative CAS RN : –EC Number: 202-394-1MDL Number : MFCD00005699Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 5-MethylisatinSynonym : CAS: 608-05-9Formula: C9H7NO2Molecular Weight : 161.16Alternative CAS RN : –EC Number: 210-152-1MDL Number : MFCD00005721Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29337900Price…
Product Name : 2-Bromobenzyl bromideSynonym : CAS: 3433-80-5Formula: C7H6Br2Molecular Weight : 249.94Alternative CAS RN : –EC Number: 222-334-8MDL Number : MFCD00000173Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Bromobenzylamine hydrochlorideSynonym : CAS: 5465-63-4Formula: C7H8BrNHClMolecular Weight : 222.52Alternative CAS RN : –EC Number: –MDL Number : MFCD00012853Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-NonadecanolSynonym : CAS: 1454-84-8Formula: CH3(CH2)18OHMolecular Weight : 284.52Alternative CAS RN : –EC Number: 215-930-4MDL Number : MFCD00002824Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29051900980Buy2-(4-Hydroxy-1H-indol-3-yl)acetic…
Product Name : 5-Bromo-2,3-difluorophenolSynonym : CAS: 186590-26-1Formula: C6H3BrF2OMolecular Weight : 208.99Alternative CAS RN : –EC Number: –MDL Number : MFCD01631350Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Methyl 14(S);15(S)-epoxy-13(R)-hydroxy-(5Z,8Z,11Z)-eicosatrienoateSynonym : (E)-4-Hydroxynonenal-dimethylacetal; 4-HNE-DMACAS: Formula: C11H22O3Molecular Weight : 202.29Alternative CAS RN : –EC Number: –MDL Number : MFCD04040010Storage Temperature : -20°CShipping Temperature : Dry iceHarmonised Tariff…
Product Name : 5-TrifluoromethylindoleSynonym : CAS: 100846-24-0Formula: C9H6F3NMolecular Weight : 185.15Alternative CAS RN : –EC Number: –MDL Number : MFCD03095341Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3-Cyano-2-phenylpropanoic…
Product Name : Calcium MitiglinideSynonym : CAS: 145525-41-3Formula: Molecular Weight : Alternative CAS RN : 207844-01-7 (2H2O)EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : Ethyl 2-ethylacetoacetateSynonym : CAS: 607-97-6Formula: C8H14O3Molecular Weight : 158.20Alternative CAS RN : –EC Number: 210-151-6MDL Number : MFCD00039898Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-HydroxybenzaldehydeSynonym : CAS: 100-83-4Formula: C7H6O2Molecular Weight : 122.12Alternative CAS RN : –EC Number: 202-892-9MDL Number : MFCD00003368Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29124900Pyrene-4,5,9,10-tetraone…
Product Name : Z-Ile-Glu(O-t-butyl)-Ala-LeucinalSynonym : N--L-isoleucyl-L-α-glutamyl-tert-butyl ester-N--L-alaninamide; PSICAS: 158442-41-2Formula: C32H50N4O8Molecular Weight : 618.76Alternative CAS RN : –EC Number: –MDL Number : MFCD00671409Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff…
Product Name : L-Iduronic acid-1,6-13C2Synonym : CAS: Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methoxyphenylhydrazine hydrochlorideSynonym : CAS: 19501-58-7Formula: C7H10N2OHClMolecular Weight : 174.63Alternative CAS RN : –EC Number: 243-115-3MDL Number : MFCD00012945Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : OlomoucineSynonym : 2-(Hydroxyethylamino)-6-benzylamino-9-methylpurineCAS: 101622-51-9Formula: C15H18N6OMolecular Weight : 298.35Alternative CAS RN : –EC Number: –MDL Number : MFCD00189360Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 3-Chloromethylpyridine hydrochloride (3-Picolylchloride hydrochloride)Synonym : CAS: 6959-48-4Formula: C6H6ClNHClMolecular Weight : 164.04Alternative CAS RN : –EC Number: 230-150-4MDL Number : MFCD00012818Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : Aminomethylphosphonic acid (AMPA)Synonym : AMPACAS: 1066-51-9Formula: CH6NO3PMolecular Weight : 111.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00008105Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 5-Iodosalicylic acidSynonym : CAS: 119-30-2Formula: C7H5IO3Molecular Weight : 264.02Alternative CAS RN : –EC Number: 204-313-5MDL Number : MFCD00002458Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Pyridine-3-boronic acid hydrochlorideSynonym : CAS: 1692-25-7Formula: C5H6BNO2Molecular Weight : 122.92Alternative CAS RN : –EC Number: –MDL Number : MFCD00674177Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : N-(4-Amino-2-chlorophenyl)phthalimideSynonym : CAS: 19348-53-9Formula: C14H9ClN2O2Molecular Weight : 272.69Alternative CAS RN : –EC Number: –MDL Number : MFCD00658249Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Diethylenetriamine pentaacetic acidSynonym : (Carboxymethylimino)bis(ethylenenitrilo)tetraacetic acid; N,N-Bis(2-ethyl)glycine; DETAPAC; DTPA; Penta(carboxymethyl)diethylenetriamine; Pentetic acidCAS: 67-43-6Formula: C14H23N3O10Molecular Weight : 393.35Alternative CAS RN : –EC Number: 200-652-8MDL Number : MFCD00004289Storage Temperature…
Product Name : Androstane-3-a,17 b-diol 3-O-b-D-glucuronide-D3Synonym : CAS: 148616-25-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 5-Amino-3-methylisoxazoleSynonym : CAS: 14678-02-5Formula: C4H6N2OMolecular Weight : 98.11Alternative CAS RN : –EC Number: 238-719-9MDL Number : MFCD00003151Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Bromo-PEG1-CH2-Boc…
Product Name : Syringic acidSynonym : 3,5-Dimethoxy-4-hydroxybenzoic acid; 4-Hydroxy-3,5-dimethoxy-benzoic acid; Gallic acid 3,5-dimethyl ether; 4-Hydroxy-3,5-dimethoxybenzoic acidCAS: 530-57-4Formula: C9H10O5Molecular Weight : 198.17Alternative CAS RN : –EC Number: 208-486-8MDL Number : MFCD00002552Storage…
Product Name : QuinazolineSynonym : CAS: 253-82-7Formula: C8H6N2Molecular Weight : 130.15Alternative CAS RN : –EC Number: 205-965-3MDL Number : MFCD00006712Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29335995Formula…
Product Name : CyclopropanecarbonitrileSynonym : CAS: 5500-21-0Formula: C4H5NMolecular Weight : 67.09Alternative CAS RN : –EC Number: 226-836-8MDL Number : MFCD00001269Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690951-(2-Hydroxy-5-iodophenyl)ethan-1-one…
Product Name : Trichloroacetyl isocyanateSynonym : CAS: 3019-71-4Formula: C3Cl3NO2Molecular Weight : 188.40Alternative CAS RN : –EC Number: 221-165-7MDL Number : MFCD00002033Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : S(+)-Propylene glycolSynonym : (S)-(+)-1,2-Propanediol; (S)-(+)-1,2-Dihydroxypropane; (S)-(+)-Propylene GlycolCAS: 4254-15-3Formula: C3H8O2Molecular Weight : 76.10Alternative CAS RN : –EC Number: –MDL Number : MFCD00004539Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : Lead(IV) oxideSynonym : Lead oxide; Lead (su)peroxide; Lead dioxide; Lead peroxideCAS: 1309-60-0Formula: PbO2Molecular Weight : 239.19Alternative CAS RN : –EC Number: 215-174-5MDL Number : MFCD00011165Storage Temperature :…
Product Name : 8-Chloroadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomerSynonym : Rp-8-Cl-cAMPSCAS: 142754-27-6Formula: C10H10ClN5O5PSNaMolecular Weight : 401.70Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 2,6-Dihydroxybenzoic acidSynonym : CAS: 303-07-1Formula: C7H6O4Molecular Weight : 154.12Alternative CAS RN : –EC Number: 206-134-8MDL Number : MFCD00002462Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-ButanolSynonym : n-Butanol; Butyl alcoholCAS: 71-36-3Formula: CH3(CH2)3OHMolecular Weight : 74.12Alternative CAS RN : –EC Number: 200-751-6MDL Number : MFCD00002964Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 2-Nitrophenyl b-D-galactopyranosideSynonym : o-Nitrophenyl β-D-galactopyranoside; o-Nitrophenyl beta-D-galactopyranoside; 2-Nitrophenyl beta-D-galactopyranoside; o-Nitrophenyl beta-D-galactoside; ONPG; ONP beta-D-galactopyranosideCAS: 369-07-3Formula: C12H15NO8Molecular Weight : 301.25Alternative CAS RN : –EC Number: 206-716-1MDL Number :…
Product Name : SU 5416Synonym : 1,3-Dihydro-3--2H-indol-2-oneCAS: 204005-46-9Formula: C15H14N2OMolecular Weight : 238.28Alternative CAS RN : –EC Number: –MDL Number : MFCD01940922Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Bromo-3,5-dichloropyridineSynonym : CAS: 14482-51-0Formula: C5H2BrCl2NMolecular Weight : 226.89Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Di(1H-pyrrol-2-yl)methane…
Product Name : CochliodinolSynonym : CAS: 11051-88-0Formula: Molecular Weight : 506.6Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –728034-12-6…
Product Name : Thiophene-2-carboxylic acid hydrazideSynonym : CAS: 2361-27-5Formula: C5H6N2OSMolecular Weight : 142.18Alternative CAS RN : –EC Number: 219-107-0MDL Number : MFCD00005435Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : PhenanthreneSynonym : CAS: 85-01-8Formula: C14H10Molecular Weight : 178.23Alternative CAS RN : –EC Number: 201-581-5MDL Number : MFCD00001168Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : 29029000856412-22-1…
Product Name : E-4031Synonym : N--4-piperidinyl]carbonyl]phenyl]methanesulfonamide dihydrochlorideCAS: 113559-13-0Formula: C21H27N3O3S · 2HClMolecular Weight : 474.44Alternative CAS RN : –EC Number: –MDL Number : MFCD01754739Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff…
Product Name : 4-Trifluoromethylphenylacetic acidSynonym : CAS: 32857-62-8Formula: C9H7F3O2Molecular Weight : 204.15Alternative CAS RN : –EC Number: 251-263-5MDL Number : MFCD00004352Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Chloro-2-methylphenylboronic acidSynonym : CAS: 148839-33-2Formula: C7H8BClO2Molecular Weight : 170.40Alternative CAS RN : –EC Number: –MDL Number : MFCD03411939Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,4,5-Triamino-6-hydroxypyrimidineSynonym : CAS: 51324-37-9Formula: C4H9Cl2N5OMolecular Weight : 214.05Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2,4-Dibromo-3-methylpyridine…
Product Name : 4-Benzyloxyaniline hydrochlorideSynonym : CAS: 51388-20-6Formula: C13H13NOHClMolecular Weight : 235.72Alternative CAS RN : –EC Number: 257-170-6MDL Number : MFCD00012995Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Magnesium chloride hexahydrateSynonym : CAS: 7791-18-6Formula: MgCl2 · 6H2OMolecular Weight : 203.30Alternative CAS RN : –EC Number: 232-094-6MDL Number : MFCD00149781Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 4-NitrophenylacetonitrileSynonym : CAS: 555-21-5Formula: C8H6N2O2Molecular Weight : 162.15Alternative CAS RN : –EC Number: 209-085-0MDL Number : MFCD00007372Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690952-chloro-4,6-dimethoxypyridine…
Product Name : 5,6-Difluoroindole-2-carboxylic acidSynonym : CAS: 169674-35-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : N-Acetyl-D-glucosamine 6-acetateSynonym : CAS: 131832-93-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Hydroxy-3-nitro-4-picoline (2-Hydroxy-4-methyl-3-nitropyridine)Synonym : CAS: 21901-18-8Formula: C6H6N2O3Molecular Weight : 154.12Alternative CAS RN : –EC Number: –MDL Number : MFCD00010689Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : PhenserineSynonym : (−)-N-Phenylcarbamoyleseroline; 1,2,3,3a,8,8a-Hexahydro-1,3a,8-trimethyl-pyrroloindol-5-ol phenylcarbamate (ester)CAS: 101246-66-6Formula: C20H23N3O2Molecular Weight : 337.42Alternative CAS RN : –EC Number: –MDL Number : MFCD00672748Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff…
Product Name : 11-alpha-HydroxyprogesteroneSynonym : (11a)-11-Hydroxypregn-4-ene-3,20-dione; 11-Hydroxyprogesterone; 4-Pregnene-11a-ol-3,20-dione; 11α-Hydroxy Progesterone; 11α-Hydroxyprogesterone; 11-α-HydroxyprogesteroneCAS: 80-75-1Formula: C21H30O3Molecular Weight : 330.46Alternative CAS RN : –EC Number: 201-306-9MDL Number : –Storage Temperature : +20°CShipping Temperature…
Product Name : Tungsten hexacarbonylSynonym : CAS: 14040-11-0Formula: C6O6WMolecular Weight : 351.91Alternative CAS RN : –EC Number: 237-880-2MDL Number : MFCD00011462Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : ElaterinideSynonym : CAS: 1398-78-3Formula: C38H54O13Molecular Weight : 718.83Alternative CAS RN : –EC Number: 215-745-9MDL Number : MFCD00046215Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : 29389090941-43-5…
Product Name : 3-Isopropylbenzoic acidSynonym : CAS: 5651-47-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-BromoindazoleSynonym : CAS: 40598-94-5Formula: C7H5BrN2Molecular Weight : 197.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00159926Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293399809003-Chloro-5-nitro-1H-pyrazole…
Product Name : CrosstideSynonym : CAS: 171783-05-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : MFCD03787963Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –1243361-03-6…
Product Name : 4-Methylumbelliferyl b-D-glucopyranosideSynonym : MUD; 4-Methylumbelliferyl beta-D-glucopyranoside; 4-Methylumbelliferyl β-D-glucopyranoside; 4MU beta-D-glucopyranosideCAS: 18997-57-4Formula: C16H18O8 · H2OMolecular Weight : 356.3Alternative CAS RN : –EC Number: 242-736-7MDL Number : MFCD00063694Storage Temperature…
Product Name : BPDSynonym : 3-(1,3-benzodioxol-5-yl)-4-phenyl-2,5-FurandioneCAS: 213481-12-0Formula: C17H10O5Molecular Weight : 294.26Alternative CAS RN : –EC Number: –MDL Number : MFCD22666591Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –1-Bromo-3-fluoro-2-methyl-4-nitrobenzene…
Product Name : N-(tert-Butyl)hydroxylamine hydrochlorideSynonym : CAS: 57497-39-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : (tert-Butylimino)tris(pyrrolidino)phosphoraneSynonym : CAS: 161118-67-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1539-42-0…
Product Name : 6-NitroquinolineSynonym : CAS: 613-50-3Formula: C9H6N2O2Molecular Weight : 174.16Alternative CAS RN : –EC Number: 210-346-6MDL Number : MFCD00006799Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29334990180532-52-9…
Product Name : 2-BromothiazoleSynonym : CAS: 3034-53-5Formula: C3H2BrNSMolecular Weight : 164.02Alternative CAS RN : –EC Number: 221-229-4MDL Number : MFCD00005316Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29341000Thienopyridin-5-amine…
Product Name : 1-BenzoylpiperazineSynonym : CAS: 13754-38-6Formula: C11H14N2OMolecular Weight : 190.24Alternative CAS RN : –EC Number: –MDL Number : MFCD00810192Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3,5-Dichloropyridopyrazine…
Product Name : trans-3-Hexenoic acidSynonym : CAS: 1577-18-0Formula: C6H10O2Molecular Weight : 114.14Alternative CAS RN : –EC Number: 216-417-8MDL Number : MFCD00002786Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : SBFI-AMSynonym : Sodium indicator SBFI-AM; Sodium-binding benzofuran isophthalate-AMCAS: 129423-53-6Formula: C56H58N2O23Molecular Weight : 1127.06Alternative CAS RN : –EC Number: –MDL Number : MFCD00082576Storage Temperature : -20°CShipping Temperature :…
Product Name : 1-Hexadecanesulfonic acid sodium saltSynonym : Cetylsulfonic acid sodium salt; Sodium 1-Hexadecanesulfonate; Hexadecylsulfonic acid sodium salt; Sodium cetylsulfonateCAS: 15015-81-3Formula: C16H33SO3NaMolecular Weight : 328.49Alternative CAS RN : –EC Number:…
Product Name : 4-n-ButylphenolSynonym : CAS: 1638-22-8Formula: C10H14OMolecular Weight : 150.22Alternative CAS RN : –EC Number: 216-672-5MDL Number : MFCD00041750Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Metformin…
Product Name : Methyl 4-hydroxybenzoate sodium saltSynonym : Sodium methyl 4-hydroxybenzoate; Methylis parahydroxybenzoas natricum; Sodium methyl paraben; Sodium methylparabenCAS: 5026-62-0Formula: C8H7NaO3Molecular Weight : 174.13Alternative CAS RN : –EC Number: 225-714-1MDL…
Product Name : Benzyl 2,6-di-O-acetyl-3,4-O-isopropylidene-β-D-galactopyranosideSynonym : CAS: 16741-10-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Thiophene-3-carboxaldehydeSynonym : CAS: 498-62-4Formula: C5H4OSMolecular Weight : 112.15Alternative CAS RN : –EC Number: 207-865-5MDL Number : MFCD00005466Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293499901207294-92-5…
Product Name : 3-Methyl-1-butanolSynonym : Isoamyl alcohol; Isopentyl alcohol; Isobutylcarbinol; IsopentanolCAS: 123-51-3Formula: C5H12OMolecular Weight : 88.15Alternative CAS RN : –EC Number: 204-633-5MDL Number : MFCD00002934Storage Temperature : +20°CShipping Temperature :…
Product Name : 4-(3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio)-1,3-benzenedisulfonateSynonym : CAS: 150849-52-8Formula: C19H11IN5O8S2•NaMolecular Weight : 651.35Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff Code :…
Product Name : (S)-(+)-2-HexanolSynonym : CAS: 52019-78-0Formula: C6H14OMolecular Weight : 102.18Alternative CAS RN : –EC Number: –MDL Number : MFCD00065955Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Ethynylpyrazine…
Product Name : 2-Amino-5,6-dihydro-6-methyl-4H-1,3-thiazineSynonym : AMTCAS: 1121-91-1Formula: C5H10N2S · HClMolecular Weight : 166.67Alternative CAS RN : –EC Number: –MDL Number : MFCD00717539Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code…
Product Name : (R)-2-MethylpyrrolidineSynonym : CAS: 41720-98-3Formula: C5H11NMolecular Weight : 85.15Alternative CAS RN : –EC Number: –MDL Number : MFCD07783026Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 29339980Formula…
Product Name : 2-Carboxy-5-fluorophenylboronic acidSynonym : CAS: 874290-62-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Tetrahydro-4H-pyran-4-oneSynonym : CAS: 29943-42-8Formula: C5H8O2Molecular Weight : 100.12Alternative CAS RN : –EC Number: 249-967-2MDL Number : MFCD00006581Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29329900Potassium…
Product Name : (R)-(-)-2-Chloromandelic acidSynonym : CAS: 52950-18-2Formula: C8H7ClO3Molecular Weight : 186.60Alternative CAS RN : –EC Number: –MDL Number : MFCD00798429Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Ciprofibrate acyl-β-D-glucuronideSynonym : CAS: 102623-15-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,2-Dimethylbutyric acidSynonym : CAS: 595-37-9Formula: C6H12O2Molecular Weight : 116.16Alternative CAS RN : –EC Number: 209-865-0MDL Number : MFCD00004200Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,2-Dimyristoyl-sn-glycero-3-phosphocholineSynonym : 1,2-Ditetradecanoyl-sn-glycero-3-phosphocholine; 3-sn-Phosphatidylcholine, 1,2-dimyristoyl; L-β,γ-Dimyristoyl-α-lecithin; 3,5,9-Trioxa-4-phosphatricosan-1-aminium; 4-hydroxy-N,N,N-trimethyl-10-oxo-7--, hydroxide, inner salt; 1,2-Dimyristoyl-sn-glycerol-3; (R)-2,3-Bis(tetradecanoyloxy)propyl phosphate; DMPC; L-b,γ-Dimyristoyl-a-lecithinCAS: 18194-24-6Formula: C36H72NO8PMolecular Weight : 677.93Alternative CAS RN : –EC Number: 242-085-9MDL…
Product Name : 2-Acetylphenylboronic acidSynonym : CAS: 308103-40-4Formula: C8H9BO3Molecular Weight : 163.97Alternative CAS RN : –EC Number: –MDL Number : MFCD01321263Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3,5-DimethoxybenzaldehydeSynonym : CAS: 7311-34-4Formula: C9H10O3Molecular Weight : 166.18Alternative CAS RN : –EC Number: 230-772-6MDL Number : MFCD00003366Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29124900N1,N1-Diphenylbenzene-1,4-diamine…
Product Name : DicambaSynonym : 3,6-dichloro-2-methoxybenzoic acid; 3,6-Dichloro-o-anisic acid; MDBACAS: 1918-00-9Formula: C8H6Cl2O3Molecular Weight : 221.03Alternative CAS RN : –EC Number: 217-635-6MDL Number : MFCD00055283Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…
Product Name : N,N-Bis(2-hydroxyethyl)-p-toluidineSynonym : CAS: 3077-12-1Formula: C11H17NO2Molecular Weight : 195.26Alternative CAS RN : –EC Number: 221-359-1MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 2922190090846549-37-9…
Product Name : 2-HydroxyethylhydrazineSynonym : CAS: 109-84-2Formula: HOCH2CH2NHNH2Molecular Weight : 76.10Alternative CAS RN : –EC Number: 203-711-6MDL Number : MFCD00007623Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29280090236406-49-8…
Product Name : 2-Chloro-5-fluoropyridineSynonym : CAS: 31301-51-6Formula: C5H3ClFNMolecular Weight : 131.54Alternative CAS RN : –EC Number: –MDL Number : MFCD03095332Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Mal-PEG4-OH…
Product Name : 5-Bromo-2′-deoxyuridine 5′-triphosphate sodium saltSynonym : 5-BrdUTPCAS: 102212-99-7Formula: C9H14BrN2O14P3Molecular Weight : 547.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00057405Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff…
Product Name : Saikosaponin ASynonym : CAS: 20736-09-8Formula: C42H68O13Molecular Weight : 780.98Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-Pentanesulfonic acid sodium salt, HPLC gradeSynonym : Sodium pentanesulfonate ; Sodium 1-pentanesulfonateCAS: 22767-49-3Formula: CH3(CH2)4SO3NaMolecular Weight : 174.19Alternative CAS RN : 207605-40-1EC Number: 245-208-4MDL Number : MFCD00007541Storage Temperature…
Product Name : 4-methylhydratropaldehydeSynonym : CAS: 99-72-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29122900Price…
Product Name : Calcium carbonate, technicalSynonym : ChalkCAS: 471-34-1Formula: CaCO3Molecular Weight : 100.09Alternative CAS RN : 1317-65-3EC Number: 207-439-9MDL Number : MFCD00010906Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : (S)-(-)-4-Benzyl-1,3-oxazolidine-2-thioneSynonym : CAS: 145588-94-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –5-Amino-2-(4-aminophenyl)benzimidazole…
Product Name : 4-Biphenylacetic acidSynonym : CAS: 5728-52-9Formula: C14H12O2Molecular Weight : 212.25Alternative CAS RN : –EC Number: 227-233-2MDL Number : MFCD00004351Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 1,3-DibromoadamantaneSynonym : CAS: 876-53-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –76578-90-0…
Product Name : Aurothioglucose hydrateSynonym : Gold thioglucose; Solganal; SolganolCAS: 12192-57-3Formula: C6H11AuO5S · xH2OMolecular Weight : 392.18 (anhydrous)Alternative CAS RN : –EC Number: 235-365-7MDL Number : –Storage Temperature : +4°CShipping…
Product Name : 4-Amino-2-methylphenolSynonym : CAS: 2835-96-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29222900N6-Diazo-L-Fmoc-lysine…
Product Name : 3-Amino-2-nitropyridineSynonym : CAS: 13269-19-7Formula: C5H5N3O2Molecular Weight : 139.11Alternative CAS RN : –EC Number: 236-260-9MDL Number : MFCD00044102Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29333999903-(Benzyloxy)cyclobutanone…
Product Name : 2-(Trimethylsilyl)-1H-1,2,3-triazoleSynonym : CAS: 13518-80-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –169566-81-8…
Product Name : a-D-Glucuronic acid 1-phosphate tripotassium salt pentahydrateSynonym : CAS: 103213-29-2Formula: C6H11O10P.3K.3(H2O)Molecular Weight : 553.55Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature :…
Product Name : 2-Fluoro-3-trifluoromethylbenzonitrileSynonym : CAS: 146070-35-1Formula: C8H3F4NMolecular Weight : 189.11Alternative CAS RN : –EC Number: –MDL Number : MFCD00061152Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : BenzoylacetonitrileSynonym : CAS: 614-16-4Formula: C9H7NOMolecular Weight : 145.16Alternative CAS RN : –EC Number: 210-369-1MDL Number : MFCD00001942Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690951-Hydroxyhept-6-yn-3-one…
Product Name : 2-Amino-2-thiazoline hydrochlorideSynonym : CAS: 3882-98-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Benzyl benzoateSynonym : Benzoic acid benzyl ester; Phenylmethyl benzoate; Phenylmethyl benzoateCAS: 120-51-4Formula: C14H12O2Molecular Weight : 212.25Alternative CAS RN : –EC Number: 204-402-9MDL Number : MFCD00003075Storage Temperature :…
Product Name : 3-Amino-5-nitrobenzoic acidSynonym : CAS: 618-84-8Formula: C7H6N2O4Molecular Weight : 182.14Alternative CAS RN : –EC Number: –MDL Number : MFCD00017025Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Endomorphin 2Synonym : CAS: 141801-26-5Formula: C32H37N5O5Molecular Weight : 571.67Alternative CAS RN : –EC Number: –MDL Number : MFCD01321064Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Hydroxythiophenol (3-Mercaptophenol)Synonym : CAS: 40248-84-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : CD-3Synonym : 4-(N-Ethyl-N-2-methanesulfonylaminoethyl)-2-methylphenylenediamine; 4-(N-ethyl-N-2-methanesulphonylaminoethyl)-2-methylphenylenediamine sesquisulphate; N-(2-(4-amino-N-ethyl-m-toluidino)ethyl)methanesulphonamide sesquisulphateCAS: 25646-71-3Formula: C11H18N2O4SMolecular Weight : 274.34Alternative CAS RN : 24567-76-8EC Number: 247-161-5MDL Number : MFCD00036418Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : Disodium hydrogen citrate sesquihydrateSynonym : Disodium citrate sesquihydrate; Citric acid disodium salt sesquihydrate; Disodium hydrogen citrate hydrate; Disodium citrate hydrate; Di-Sodium hydrogen citrate sesquihydrate; Citric acid, disodium…
Product Name : 6-MethoxycoumarinSynonym : CAS: 17372-53-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –6-Aminonaphthalene-1,3-disulfonic…
Product Name : 3-Cyano-5-methylpyridine (3-Cyano-5-picoline)Synonym : CAS: 42885-14-3Formula: C7H6N2Molecular Weight : 118.14Alternative CAS RN : –EC Number: 255-988-8MDL Number : MFCD00673151Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methylumbelliferyl 6-Thio-palmitate-β-D-glucopyranosideSynonym : CAS: 229644-17-1Formula: Molecular Weight : 592.78Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 7-Benzyloxy-4-trifluoromethylcoumarinSynonym : BFC; 7-benzyloxy-4-trifluoromethyl-coumarinCAS: 220001-53-6Formula: C17H11F3O3Molecular Weight : 320.26Alternative CAS RN : –EC Number: –MDL Number : MFCD01564466Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Carnosic acidSynonym : CAS: 3650-09-7Formula: C20H28O4Molecular Weight : 332.43Alternative CAS RN : –EC Number: –MDL Number : MFCD02259459Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Phenoxyethanol, USP-NF gradeSynonym : 2-Phenoxyethyl alcohol; Ethylene glycol, 2-monophenyl ether; 2-PhenoxyethanolCAS: 122-99-6Formula: C8H10O2Molecular Weight : 138.17Alternative CAS RN : –EC Number: 204-589-7MDL Number : MFCD00002857Storage Temperature :…
Product Name : 3-HydroxypiperidineSynonym : CAS: 6859-99-0Formula: C5H11NOMolecular Weight : 101.15Alternative CAS RN : –EC Number: 229-957-4MDL Number : MFCD00014591Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293339994-Hydroxybenzenesulfonyl…
Product Name : XylazineSynonym : 2-(2,6-Dimethylphenylamino)-5,6-dihydro-4H-thiazine hydrochlorideCAS: 7361-61-7Formula: C12H16N2SMolecular Weight : 220.33Alternative CAS RN : –EC Number: 230-902-1MDL Number : MFCD00057908Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-Amino-5-methylbenzenethiolSynonym : CAS: 23451-96-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –(4,5-Dimethoxy-2-nitrophenyl)methanol…
Product Name : DecylamineSynonym : CAS: 2016-57-1Formula: C10H23NMolecular Weight : 157.30Alternative CAS RN : –EC Number: 217-957-7MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292119992-(3-Butyn-1-yloxy)acetic…
Product Name : (+)-10,2-CamphorsultamSynonym : CAS: 108448-77-7Formula: C10H17NO2SMolecular Weight : 215.32Alternative CAS RN : –EC Number: –MDL Number : MFCD00151762Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Bis(2-(2-methoxyethoxy)ethyl)amine…
Product Name : 3-TrifluoromethylpyrazoleSynonym : CAS: 20154-03-4Formula: C4H3F3N2Molecular Weight : 136.08Alternative CAS RN : –EC Number: –MDL Number : MFCD00115018Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4-Bromo-3-hydroxypyridine…
Product Name : ICI 204,448 hydrochlorideSynonym : (±)-1--3--2-butanol hydrochloride; R,S-methylamino]-2-(1-pyrrolidinyl)ethyl] phenoxy]-acetic acid hydrochloride; (RS)-methylamino]-2-(1-pyrrolidinyl)ethyl]phenoxy]acetic acid hydrochlorideCAS: 121264-04-8Formula: C23H26Cl2N2O4 · HClMolecular Weight : 501.83Alternative CAS RN : –EC Number: –MDL Number…
Product Name : Astragaloside IISynonym : CAS: 84676-89-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,5-Diaminobenzenesulfonic acidSynonym : CAS: 88-45-9Formula: C6H8N2O3SMolecular Weight : 188.20Alternative CAS RN : –EC Number: 201-832-9MDL Number : MFCD00007904Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Chlorophenyl cyclopropyl ketone 98%Synonym : CAS: 6640-25-1Formula: C10H9ClOMolecular Weight : 180.63Alternative CAS RN : –EC Number: 229-655-2MDL Number : MFCD00001295Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : 3-FluorobenzotrichlorideSynonym : CAS: 401-77-4Formula: C7H4Cl3FMolecular Weight : 213.47Alternative CAS RN : –EC Number: 206-931-0MDL Number : MFCD00042073Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1450754-37-6…
Product Name : Bis-trifluoroacetoxyiodobenzeneSynonym : benzene; BTI; Iodobenzene I,I-bis(trifluoroacetate); PIFA; Iodosobenzene bis(trifluoroacetate)CAS: 2712-78-9Formula: C10H5F6IO4Molecular Weight : 430.04Alternative CAS RN : –EC Number: 220-308-0MDL Number : MFCD00009672Storage Temperature : +20°CShipping Temperature…
Product Name : Iron(III) oxide, technicalSynonym : CAS: 1309-37-1Formula: Fe2O3Molecular Weight : 159.69Alternative CAS RN : –EC Number: 215-168-2MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Ase, TGFBR3 mRNA expression inversely correlated with MYCN mRNA expression (Figure 2C). To investigate regardless of whether MYCN suppresses TRIII expression in NB cells, we applied complementary inducible and repressible…
Product Name : Magnesium sulfate heptahydrateSynonym : Magnesium sulphate heptahydrate; Epsom saltsCAS: 10034-99-8Formula: MgSO4 · 7H2OMolecular Weight : 246.48Alternative CAS RN : –EC Number: 231-298-2MDL Number : MFCD00149785Storage Temperature :…
Product Name : Betamethasone 21-phosphate disodiumSynonym : 9-Fluoro-11β,17,21-trihydroxy-16β-methylpregna-1,4-diene-3,20-dione 21-(disodium phosphate)CAS: 151-73-5Formula: C22H28FNa2O8PMolecular Weight : 516.40Alternative CAS RN : –EC Number: 205-797-0MDL Number : MFCD00200361Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…
Product Name : 2-Cyano-5-methylpyridine (2-Cyano-5-picoline)Synonym : CAS: 1620-77-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,2,3,4-TetrahydronaphthaleneSynonym : CAS: 119-64-2Formula: C10H12Molecular Weight : 132.21Alternative CAS RN : –EC Number: 204-340-2MDL Number : MFCD00001733Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29029000Cubane-1-carboxylic…
Product Name : 1,8-NaphthalenediolSynonym : Naphthalene-1,8-diol; 1,8-DihydroxynaphthaleneCAS: 569-42-6Formula: C10H8O2Molecular Weight : 160.20Alternative CAS RN : –EC Number: –MDL Number : MFCD00042701Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Dehydroabietic acidSynonym : CAS: 1740-19-8Formula: C20H28O2Molecular Weight : 300.44Alternative CAS RN : –EC Number: 217-102-8MDL Number : MFCD09839012Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Nitro-1-naphtholSynonym : CAS: 607-24-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290899001450754-37-6…
Product Name : Methyl a-L-rhamnopyranosideSynonym : CAS: 14917-55-6Formula: C7H14O5Molecular Weight : 178.19Alternative CAS RN : –EC Number: 238-987-7MDL Number : MFCD00067654Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-MethylbenzotrifluorideSynonym : CAS: 6140-17-6Formula: C8H7F3Molecular Weight : 160.14Alternative CAS RN : –EC Number: 228-124-2MDL Number : MFCD00075476Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –13-Bromotridec-1-ene…
Product Name : CI-994Synonym : 4-Acetylamino-N-(2′-aminophenyl)benzamide; Acetyldinaline; Tacedinaline; CI−994CAS: 112522-64-2Formula: C15H15N3O2Molecular Weight : 269.30Alternative CAS RN : –EC Number: –MDL Number : MFCD00866266Storage Temperature : +20°CShipping Temperature : –Harmonised Tariff…
Product Name : 3-Methylindole (Skatole)Synonym : CAS: 83-34-1Formula: C9H9NMolecular Weight : 131.18Alternative CAS RN : –EC Number: 201-471-7MDL Number : MFCD00005627Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-Bromo-3,4-difluorobenzeneSynonym : CAS: 348-61-8Formula: C6H3BrF2Molecular Weight : 192.99Alternative CAS RN : –EC Number: 206-481-5MDL Number : MFCD00000304Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1350518-27-2…
Product Name : DicyclopentadieneSynonym : CAS: 77-73-6Formula: C10H12Molecular Weight : 132.21Alternative CAS RN : –EC Number: 201-052-9MDL Number : MFCD00078246Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29021900Buy674287-63-9…
Product Name : (1S,2S)-(+)-2-Amino-1-phenyl-1,3-propanediolSynonym : CAS: 28143-91-1Formula: C9H13NO2Molecular Weight : 167.21Alternative CAS RN : –EC Number: 248-867-6MDL Number : MFCD00004503Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29221985900(+)-Sparteine…
Product Name : 4-Chloro-2-fluorobenzaldehydeSynonym : CAS: 61072-56-8Formula: C7H4ClFOMolecular Weight : 158.56Alternative CAS RN : –EC Number: –MDL Number : MFCD00143282Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1,12-Dibromododecane…
Product Name : 2-Nitro-4-trifluoromethylbenzonitrileSynonym : CAS: 778-94-9Formula: C8H3F3N2O2Molecular Weight : 216.12Alternative CAS RN : –EC Number: 212-298-1MDL Number : MFCD00014684Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy8-Hydroxyjulolidine…
Product Name : 1,3-DiethylureaSynonym : CAS: 623-76-7Formula: C5H12N2OMolecular Weight : 116.16Alternative CAS RN : –EC Number: 210-811-3MDL Number : MFCD00009028Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29241900878155-85-2…
Product Name : 4-Methyl-3-cyclohexen-1-oneSynonym : CAS: 5259-65-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1795451-70-5…
Product Name : Di-tert-butyl azodicarboxylateSynonym : CAS: 870-50-8Formula: (CH3)3CO2C-N=N-CO2C(CH3)3Molecular Weight : 230.27Alternative CAS RN : –EC Number: 212-796-9MDL Number : MFCD00015001Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : SalicylanilideSynonym : CAS: 87-17-2Formula: C13H11NO2Molecular Weight : 213.24Alternative CAS RN : –EC Number: 201-727-8MDL Number : MFCD00002212Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29242998Buy1310481-47-0…
Product Name : RifabutinSynonym : Ansamycin; Ansatipine; LM-427; MycobutinCAS: 72559-06-9Formula: C46H62N4O11Molecular Weight : 847.00Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised…
Product Name : 3,5-Bis-trifluoromethylphenolSynonym : CAS: 349-58-6Formula: C8H4F6OMolecular Weight : 230.11Alternative CAS RN : –EC Number: 206-488-3MDL Number : MFCD00000386Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1479-58-9…
Product Name : N9-IsopropylolomoucineSynonym : 2-(2′-Hydroxyethylamino)-6-benzylamino-9-isopropylpurineCAS: 158982-15-1Formula: C17H22N6OMolecular Weight : 326.40Alternative CAS RN : –EC Number: –MDL Number : MFCD01310377Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –1867923-49-6…
Product Name : 2,3,5,6-TetrafluoroanilineSynonym : CAS: 700-17-4Formula: C6H3F4NMolecular Weight : 165.09Alternative CAS RN : –EC Number: 211-840-4MDL Number : MFCD00007644Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29214200878167-55-6…
Product Name : 5”-Bromo-2”-hydroxyacetophenoneSynonym : CAS: 1450-75-5Formula: C8H7BrO2Molecular Weight : 215.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00191850Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy5-Ethoxypyridin-2-amine…
Product Name : 4-Chloro-3-nitrophenylboronic acidSynonym : CAS: 151169-67-4Formula: C6H5BClNO4Molecular Weight : 201.37Alternative CAS RN : –EC Number: –MDL Number : MFCD02258950Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,8-Diazabicyclo(5.4.0)undec-7-eneSynonym : CAS: 6674-22-2Formula: C9H16N2Molecular Weight : 152.24Alternative CAS RN : –EC Number: 229-713-7MDL Number : MFCD00006930Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29335995(6-Bromopyridin-2-yl)methanamine…
Product Name : Iron(ll) chloride anhydrousSynonym : CAS: 7758-94-3Formula: Cl2FeMolecular Weight : 126.75Alternative CAS RN : –EC Number: 231-843-4MDL Number : MFCD00011004Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 2-Azidoethyl 2,3,4,6-tetra-O-acetyl-β-D-galactopyranosideSynonym : CAS: 139888-80-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Fluoro-2-trifluoromethylpyridineSynonym : CAS: 936841-73-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1071520-51-8…
Product Name : 1-Adamantylmethyl ketone (1-Acetyladamantane)Synonym : CAS: 1660-04-4Formula: C12H18OMolecular Weight : 178.27Alternative CAS RN : –EC Number: 216-761-9MDL Number : MFCD00074739Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 3,5-DichlorobenzotrifluorideSynonym : CAS: 54773-20-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –H-Leu-OMe.HCl…
Product Name : Tyrphostin 51Synonym : 2-Amino-1,1,3-tricyano-4-(3′,4′,5′-trihydroxyphenyl)butadieneCAS: 126433-07-6Formula: C13H8N4O3Molecular Weight : 268.23Alternative CAS RN : –EC Number: –MDL Number : MFCD00133903Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : Dimezone (4,4-Dimethyl-1-phenyl-3-pyrazolidinone)Synonym : CAS: 2654-58-2Formula: C11H14N2OMolecular Weight : 190.24Alternative CAS RN : –EC Number: 220-181-1MDL Number : MFCD00044325Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : CKI-7 dihydrochlorideSynonym : N-(2-Aminoethyl)-5-chloroisoquinoline-8-sulphonamide dihydrochlorideCAS: 1177141-67-1Formula: C11H12ClN3O2S · 2HClMolecular Weight : 358.67Alternative CAS RN : –EC Number: –MDL Number : MFCD00897689Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : 2,6-DiisopropylnaphthaleneSynonym : CAS: 24157-81-1Formula: C16H20Molecular Weight : 212.33Alternative CAS RN : –EC Number: 246-045-1MDL Number : MFCD00021648Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 1,2-Epoxy-5-hexeneSynonym : CAS: 10353-53-4Formula: C6H10OMolecular Weight : 98.15Alternative CAS RN : –EC Number: –MDL Number : MFCD00010051Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 2910900090Price…
Product Name : ICI 192605Synonym : (4Z)-rel-; 4(Z)-6-(2-o-chlorophenyl-4-o-hydroxyphenyl-1,3-dioxan-cis-5-yl) hexenoic acid; 4-Hexenoic acid; 6--CAS: 117621-64-4Formula: C22H23ClO5Molecular Weight : 402.87Alternative CAS RN : –EC Number: –MDL Number : MFCD00673936Storage Temperature : -20°CShipping…
Product Name : 4-Bromo-3,5-dimethoxybenzoic acidSynonym : CAS: 56518-42-4Formula: C9H9BrO4Molecular Weight : 261.07Alternative CAS RN : –EC Number: –MDL Number : MFCD01632140Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Fluoro-4-methylanilineSynonym : CAS: 452-80-2Formula: C7H8FNMolecular Weight : 125.15Alternative CAS RN : –EC Number: –MDL Number : MFCD00040975Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –27194-74-7…
Product Name : 2-Hydroxynicotinic acidSynonym : CAS: 609-71-2Formula: C6H5NO3Molecular Weight : 139.11Alternative CAS RN : –EC Number: 210-198-2MDL Number : MFCD00010100Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,3:4,6-Di-O-isopropylidene-a-L-sorbofuranoseSynonym : CAS: 17682-70-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4CzIPN…
Product Name : 4-Bromopyridine hydrochlorideSynonym : CAS: 19524-06-2Formula: C5H4BrNHClMolecular Weight : 194.46Alternative CAS RN : –EC Number: 243-128-4MDL Number : MFCD00012828Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 6-(5H)-PhenanthridinoneSynonym : NSC 11021; NSC 40943; NSC 61083CAS: 1015-89-0Formula: C13H9NOMolecular Weight : 195.22Alternative CAS RN : –EC Number: 213-804-3MDL Number : MFCD00004988Storage Temperature : +20°CShipping Temperature :…
Product Name : NordentatinSynonym : CAS: 17820-07-4Formula: C19H20O4Molecular Weight : 312.36Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Tetrahydro-2H-pyran-4-carbaldehyde…
Product Name : (S)-(+)-O-Acetyl-L-mandelic acidSynonym : CAS: 7322-88-5Formula: C10H10O4Molecular Weight : 194.19Alternative CAS RN : –EC Number: –MDL Number : MFCD00064215Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Magnesium iodide anhydrous, 99.998% trace metals basisSynonym : CAS: 10377-58-9Formula: I2MgMolecular Weight : 278.12Alternative CAS RN : –EC Number: 233-825-1MDL Number : MFCD00049485Storage Temperature : –Shipping Temperature…
Product Name : Allyl triphenylphosphonium bromideSynonym : CAS: 1560-54-9Formula: (CH2=CHCH2)(C6H5)3PBrMolecular Weight : 383.27Alternative CAS RN : –EC Number: 216-332-6MDL Number : MFCD00011808Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 2-Chloro-5-iodopyridineSynonym : CAS: 69045-79-0Formula: C5H3ClINMolecular Weight : 239.44Alternative CAS RN : –EC Number: –MDL Number : MFCD01863635Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293339999001,2,3,4-Tetrahydroquinolin-5-ol…
Product Name : SPV-106Synonym : 2-Pentadecylidene-Propanedioic acid 1,3-diethyl ester; Pentadecylidenemalonate 1bCAS: 1036939-38-4Formula: C22H40O4Molecular Weight : 368.55Alternative CAS RN : –EC Number: –MDL Number : MFCD20527327Storage Temperature : +4°CShipping Temperature :…
Product Name : 2-Amino-5-fluoropyridineSynonym : CAS: 21717-96-4Formula: C5H5FN2Molecular Weight : 112.11Alternative CAS RN : –EC Number: –MDL Number : MFCD01861120Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29333999901415559-47-5…
Product Name : 5-Amino-2-hydroxypyridineSynonym : CAS: 33630-94-3Formula: C5H6N2OMolecular Weight : 110.12Alternative CAS RN : –EC Number: –MDL Number : MFCD03427652Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Ethyl…
Product Name : Prostaglandin B2Synonym : (5Z,13E,15S)-15-Hydroxy-9-oxoprosta-5,8(12);13-trien-1-oic acid; PGB2CAS: 13367-85-6Formula: C20H30O4Molecular Weight : 334.45Alternative CAS RN : –EC Number: –MDL Number : MFCD00065730Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff…
Product Name : 2-(Dimethoxymethyl)-5-(methoxymethyl)furanSynonym : CAS: 110339-34-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buym-PEG12-acid…
Product Name : 1-Ethyl-4-piperidoneSynonym : CAS: 3612-18-8Formula: C7H13NOMolecular Weight : 127.19Alternative CAS RN : –EC Number: 222-781-9MDL Number : MFCD00013356Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293339991047991-79-6…
Product Name : 2-Methylphenylboronic acidSynonym : CAS: 16419-60-6Formula: C7H9BO2Molecular Weight : 135.96Alternative CAS RN : –EC Number: –MDL Number : MFCD00093526Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Fluoro-3-methylindoleSynonym : CAS: 392-13-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –942518-20-9…
Product Name : 4-BromophenetoleSynonym : 4-Bromophenyl ethyl etherCAS: 588-96-5Formula: C8H9BrOMolecular Weight : 201.06Alternative CAS RN : –EC Number: 209-629-7MDL Number : MFCD00000098Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 5-Mercapto-1-phenyltetrazoleSynonym : CAS: 86-93-1Formula: C7H6N4SMolecular Weight : 178.22Alternative CAS RN : –EC Number: 201-710-5MDL Number : MFCD00003129Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293399801337880-39-3…
Product Name : 2-Fluorophenylhydrazine hydrochlorideSynonym : CAS: 2924-15-4Formula: C6H7FN2HClMolecular Weight : 162.60Alternative CAS RN : –EC Number: 220-885-9MDL Number : MFCD00012927Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Acetamido-2-deoxy-6-O-sialyl-D-galactopyranosideSynonym : CAS: 72506-87-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –469912-82-1…
Product Name : Aceroside VIIISynonym : CAS: 104109-46-8Formula: C30H42O12Molecular Weight : 594.65Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-Deoxy-1-nitro-D-sorbitolSynonym : CAS: 14199-88-3Formula: C6H13NO7Molecular Weight : 211.17Alternative CAS RN : –EC Number: 238-052-3MDL Number : MFCD00069889Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Methyl…
Product Name : Ethyl nipecotateSynonym : CAS: 5006-62-2Formula: C8H15NO2Molecular Weight : 157.21Alternative CAS RN : –EC Number: 225-681-3MDL Number : MFCD00005991Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,1,1-trifluorohexane-2,4-dioneSynonym : CAS: 400-54-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1021-25-6…
Product Name : 2-HydroxycarbazoleSynonym : CAS: 86-79-3Formula: C12H9NOMolecular Weight : 183.21Alternative CAS RN : –EC Number: 201-699-7MDL Number : MFCD00004962Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29339980Buy181374-43-6…
Product Name : Soda lime, granular, with indicatorSynonym : Mixture of Sodium Hydroxide and Calcium Hydroxide; Soda-limeCAS: 8006-28-8Formula: –Molecular Weight : –Alternative CAS RN : –EC Number: –MDL Number :…
Product Name : 2-Amino-4,6-dichloropyrimidineSynonym : CAS: 56-05-3Formula: C4H3Cl2N3Molecular Weight : 164.00Alternative CAS RN : –EC Number: 200-253-9MDL Number : MFCD00006090Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29335995944902-01-6…
Product Name : N-CarbethoxyphthalimideSynonym : CAS: 22509-74-6Formula: C11H9NO4Molecular Weight : 219.20Alternative CAS RN : –EC Number: 245-048-5MDL Number : MFCD00005893Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –951173-34-5…
Product Name : 7-Methyloctanoic acidSynonym : CAS: 693-19-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : N-IodosuccinimideSynonym : 2,5-Dioxo-1-iodopyrrolidine; 1-Iodopyrrolidine-2,5-dione; 1-Iodo-2,5-pyrrolidinedioneCAS: 516-12-1Formula: C4H4INO2Molecular Weight : 224.99Alternative CAS RN : –EC Number: 208-221-6MDL Number : MFCD00005512Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : di-Potassium hydrogen phosphate, anhydrousSynonym : Dipotassium hydrogenphosphate; Dipotassium phosphate; sec.-Potassium phosphate; Potassium phosphate dibasic; Potassium phosphate, dibasicCAS: 7758-11-4Formula: K2HPO4Molecular Weight : 174.18Alternative CAS RN : –EC Number:…
Product Name : 2-Amino-4-hydroxypyrrolopyrimidineSynonym : CAS: 7355-55-7Formula: C6H6N4OMolecular Weight : 150.14Alternative CAS RN : –EC Number: –MDL Number : MFCD00079103Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buytert-Butyl…
Product Name : Water, distilledSynonym : Aqua PurificataCAS: 7732-18-5Formula: H2OMolecular Weight : 18.02Alternative CAS RN : –EC Number: 231-791-2MDL Number : MFCD00011332Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 1-Aminohydantoin hydrochlorideSynonym : CAS: 2827-56-7Formula: C3H5N3O2HClMolecular Weight : 151.56Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Ethyl 4,6-(4-Methoxybenzylidene)-β-D-thiogalactopyranosideSynonym : CAS: 311797-19-0Formula: Molecular Weight : 342.41Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Bromo-3-fluorobenzotrifluorideSynonym : CAS: 104540-42-3Formula: C7H3BrF4Molecular Weight : 243.00Alternative CAS RN : –EC Number: –MDL Number : MFCD00061243Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1047991-79-6…
Product Name : 2-Amino-5-methylpyridine (2-Amino-5-picoline)Synonym : CAS: 1603-41-4Formula: C6H8N2Molecular Weight : 108.14Alternative CAS RN : –EC Number: 216-503-5MDL Number : MFCD00006328Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,5-Dichlorophenylboronic acidSynonym : CAS: 135145-90-3Formula: C6H5BCl2O2Molecular Weight : 190.82Alternative CAS RN : –EC Number: –MDL Number : MFCD01863182Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,3-PhenylenediacetonitrileSynonym : CAS: 626-22-2Formula: C10H8N2Molecular Weight : 156.19Alternative CAS RN : –EC Number: 210-936-3MDL Number : MFCD00001915Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 2926909539692-67-6…
Product Name : Sodium carbonate monohydrateSynonym : CAS: 5968-11-6Formula: Na2CO3 · H2OMolecular Weight : 124.00Alternative CAS RN : –EC Number: 207-838-8MDL Number : MFCD00149177Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 2-Amino-5-chlorobenzophenoneSynonym : (2-Amino-5-chlorophenyl)(phenyl)methanoneCAS: 719-59-5Formula: C13H10ClNOMolecular Weight : 231.68Alternative CAS RN : –EC Number: 211-949-7MDL Number : MFCD00007839Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29223900Fmoc-1-Nal-OH…
Product Name : Ammonium trihydrogen diphosphateSynonym : CAS: 13765-35-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 1-OctadecanolSynonym : Octadecyl alcohol; Stearyl alcohol; n-Octadecyl alcoholCAS: 112-92-5Formula: C18H38OMolecular Weight : 270.50Alternative CAS RN : –EC Number: 204-017-6MDL Number : MFCD00002823Storage Temperature : +20°CShipping Temperature :…
Product Name : 3,4-Di-O-acetyl-1,2-O-isopropylidene-5-O-tosyl-α-L-sorboseSynonym : CAS: 53821-66-2Formula: Molecular Weight : 458.48Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Azetidin-2-one…
Product Name : 1-(Bromomethyl)naphthaleneSynonym : CAS: 3163-27-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1112178-31-0…
Product Name : 2-EthynylpyridineSynonym : CAS: 1945-84-2Formula: C7H5NMolecular Weight : 103.12Alternative CAS RN : –EC Number: –MDL Number : MFCD00041598Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –61098-37-1…
Product Name : Diphenylacetic acidSynonym : CAS: 117-34-0Formula: C14H12O2Molecular Weight : 212.25Alternative CAS RN : –EC Number: 204-185-0MDL Number : MFCD00004251Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Sodium benzotriazolateSynonym : CAS: 15217-42-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : TipifarnibSynonym : CAS: 192185-72-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29337900Formula…
Product Name : Methoxymethyl triphenylphosphonium chlorideSynonym : CAS: 4009-98-7Formula: C20H20ClOPMolecular Weight : 342.81Alternative CAS RN : –EC Number: 223-664-5MDL Number : MFCD00011800Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : Ponasterone ASynonym : 2β,3β,14α,20R,22R-Pentahydroxy-5β-cholest-7-en-6-one; 25-Deoxy-20-hydroxyecdysone; 25-DeoxyecdysteroneCAS: 13408-56-5Formula: C27H44O6Molecular Weight : 464.63Alternative CAS RN : –EC Number: –MDL Number : MFCD00272144Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff…
Product Name : 3-Cyanophenylboronic acidSynonym : CAS: 150255-96-2Formula: C7H6BNO2Molecular Weight : 146.94Alternative CAS RN : –EC Number: –MDL Number : MFCD01318967Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,4-Phenylenediamine sulfateSynonym : CAS: 16245-77-5Formula: C6H8N2H2SO4Molecular Weight : 206.22Alternative CAS RN : –EC Number: 240-357-1MDL Number : MFCD00035510Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 6-Methoxyindole-2-carboxylic acidSynonym : CAS: 16732-73-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Sulfamethoxazole b-D-glucuronideSynonym : CAS: 14365-52-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Benzalkonium chloride, 50% solution in waterSynonym : Alkylbenzyldimethylammonium chloride; Alkyldimethylbenzylammonium chloride; Benzalkonii chloridum; Benzalkonium chloride solution; Benzalkonium chloride 50% solution; Alkyldimethylbenzylammonium chloride (50% in water); Benzyldimethylalkylammonium chloride…
Product Name : 9-Fluorenecarboxylic acidSynonym : CAS: 1989-33-9Formula: C14H10O2Molecular Weight : 210.23Alternative CAS RN : –EC Number: 217-866-2MDL Number : MFCD00001136Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-PropanethiolSynonym : 1-PP; n-Propylmercaptan; Mercaptan C3CAS: 107-03-9Formula: C3H8SMolecular Weight : 76.16Alternative CAS RN : –EC Number: 203-455-5MDL Number : MFCD00004900Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : Indole-4-acetonitrileSynonym : CAS: 30933-66-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1638744-20-3…
Product Name : 3-Fluorobenzoic acidSynonym : CAS: 455-38-9Formula: C7H5FO2Molecular Weight : 140.11Alternative CAS RN : –EC Number: 207-248-0MDL Number : MFCD00002489Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Ethoxycinnamic acidSynonym : CAS: 69038-81-9Formula: C11H12O3Molecular Weight : 192.22Alternative CAS RN : –EC Number: –MDL Number : MFCD00016839Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Amino-4,6-dimethylpyridineSynonym : 6-Amino-2,4-lutidineCAS: 5407-87-4Formula: C7H10N2Molecular Weight : 122.17Alternative CAS RN : –EC Number: 226-470-9MDL Number : MFCD00006322Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293339994-Phenylpyridin-2-ol…
Product Name : Gentisic acidSynonym : 2,5-DHBA; DHB; 2,5-Dihydroxybenzoic acid; Hydroquinonecarboxylic acidCAS: 490-79-9Formula: C7H6O4Molecular Weight : 154.12Alternative CAS RN : –EC Number: 207-718-5MDL Number : MFCD00002460Storage Temperature : +20°CShipping Temperature…
Product Name : IsopropylcyclohexaneSynonym : CAS: 696-29-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29021900Formula…
Product Name : Luteolin-7-O-D-glucopyranosideSynonym : Luteolin 7-O-β-D-glucosideCAS: 5373-11-5Formula: C21H20O11Molecular Weight : 448.38Alternative CAS RN : –EC Number: 226-365-8MDL Number : MFCD06799436Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2,4,5-Trifluorobenzoic acidSynonym : CAS: 446-17-3Formula: C7H3F3O2Molecular Weight : 176.10Alternative CAS RN : –EC Number: –MDL Number : MFCD00013306Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Bromo-2-fluorobenzonitrileSynonym : CAS: 179897-89-3Formula: C7H3BrFNMolecular Weight : 200.01Alternative CAS RN : –EC Number: –MDL Number : MFCD00143424Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Iodoacetic acid sodium saltSynonym : Sodium iodoacetateCAS: 305-53-3Formula: ICH2COONaMolecular Weight : 207.93Alternative CAS RN : –EC Number: 206-165-7MDL Number : –Storage Temperature : -20°CShipping Temperature : AmbientHarmonised…
Product Name : Berberine chloride hydrateSynonym : Natural Yellow 18CAS: 141433-60-5Formula: C20H18ClNO4xH2OMolecular Weight : 371.82Alternative CAS RN : –EC Number: 211-195-9MDL Number : MFCD00011939Storage Temperature : –Shipping Temperature : –Harmonised…
Product Name : 3-MethoxyphenethylamineSynonym : CAS: 2039-67-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 2-Bromo-2-chloro-1,1,1-trifluoroethaneSynonym : HalothaneCAS: 151-67-7Formula: CF3CHBrClMolecular Weight : 197.39Alternative CAS RN : –EC Number: 205-796-5MDL Number : MFCD00009602Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 290379901190861-74-5…
Product Name : Xanthine sodium saltSynonym : 2,6-Dihydroxypurine; Xanthine sodium salt hydrate; Xanthine sodium salt monohydrate; 2,6-Dihydroxypurine hydrate; 2,6-Dihydroxypurine monohydrateCAS: 1196-43-6Formula: C5H3N4NaO2Molecular Weight : 174.09Alternative CAS RN : –EC Number:…
Product Name : Europium chloride hexahydrateSynonym : CAS: 13759-92-7Formula: EuCl3 · 6H2OMolecular Weight : 366.41Alternative CAS RN : –EC Number: 233-040-4MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 3-Chloro-2,4-difluorobenzoic acidSynonym : CAS: 154257-75-7Formula: C7H3ClF2O2Molecular Weight : 192.55Alternative CAS RN : –EC Number: –MDL Number : MFCD01631387Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,4-DiisocyanatobutaneSynonym : CAS: 4538-37-8Formula: C6H8N2O2Molecular Weight : 140.14Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 2929100090Tetrabenzyl…
Product Name : Sodium diatrizoateSynonym : 3,5-Diacetamido-2,4,6-triiodobenzoic acid sodium salt; 3,5-Bis(acetylamino)-2,4,6-triiodobenzoic acid, sodium salt; 3,5-Diacetamido-2,4,6-triiodobenzoic acid sodium salt; Diatrizoic acid sodium salt hydrate; Diatrizoate sodium; Benzoic acid, 3,5-bis(acetylamino)-2,4,6-triiodo-, monosodium salt;…
Product Name : 2-Furoic acidSynonym : CAS: 88-14-2Formula: C5H4O3Molecular Weight : 112.08Alternative CAS RN : –EC Number: 201-803-0MDL Number : MFCD00003238Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Capsicum oleoresin, 40%, USP gradeSynonym : Capsicum frutescens L; Capricum oleoresin, oil solubleCAS: 8023-77-6Formula: –Molecular Weight : –Alternative CAS RN : 84603-55-4EC Number: 283-256-8MDL Number : –Storage…
Product Name : Tafamidis acyl-β-D-glucuronideSynonym : CAS: Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : N-(3-Aminopropyl)-n-dodecylpropane-1,3-diamineSynonym : Laurylamine dipropylenediamine; N-(3-Aminopropyl)-n-dodecylpropane-1,3-diamine; N,N-bis(3-aminopropyl)dodecylamineCAS: 2372-82-9Formula: C18H41N3Molecular Weight : 299.54Alternative CAS RN : –EC Number: –MDL Number : MFCD04112927Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 2-IminobiotinSynonym : Guanidinobiotin; Hexahydro-2-imino-1H-thienoimidazole-4-pentanoic acidCAS: 13395-35-2Formula: C10H17N3O2SMolecular Weight : 243.33Alternative CAS RN : –EC Number: –MDL Number : MFCD00066150Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code…
Product Name : HexamethylenediisocyanateSynonym : 1,6-DiisocyanatohexaneCAS: 822-06-0Formula: OCN(CH2)6NCOMolecular Weight : 168.19Alternative CAS RN : –EC Number: 212-485-8MDL Number : MFCD00002047Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 29291000Price…
Product Name : 1,2,3-TriazoleSynonym : 1H-1,2,3-TriazoleCAS: 288-36-8Formula: C2H3N3Molecular Weight : 69.07Alternative CAS RN : –EC Number: –MDL Number : MFCD00014490Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 2933998090BuyTrifluridine…
Product Name : DimethylcyanamideSynonym : CAS: 1467-79-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690951018446-95-1…
Product Name : 4-EthoxybenzaldehydeSynonym : CAS: 10031-82-0Formula: C9H10O2Molecular Weight : 150.18Alternative CAS RN : –EC Number: 233-093-3MDL Number : MFCD00003388Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29124900Methyl…
Product Name : EthinamateSynonym : 1-Ethynylcyclohexanol carbamateCAS: 126-52-3Formula: C9H13NO2Molecular Weight : 167.21Alternative CAS RN : –EC Number: 204-789-4MDL Number : MFCD00063343Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-O-(2-Acetamido-2-deoxy-α-D-galactopyranosyl)-D-galactoseSynonym : CAS: 503551-82-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4,6-Dichloropyridin-2-amine…
Product Name : 2-Fluoro-3-nitro-4-picoline (2-Fluoro-4-methyl-3-nitropyridine)Synonym : CAS: 19346-43-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 7-Deaza-2′-deoxyguanosine 5′-triphosphate lithium saltSynonym : −N7-dGTP; 7-Deaza-dGTPCAS: 101515-08-6Formula: C11H17N4O13P3Molecular Weight : 506.19Alternative CAS RN : –EC Number: –MDL Number : MFCD00171614Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : Nitrobenzo-18-Crown-6Synonym : CAS: 53408-96-1Formula: C16H23NO8Molecular Weight : 357.35Alternative CAS RN : –EC Number: –MDL Number : MFCD00143207Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29329900903-Methyloxazolidine-2,5-dione…
Product Name : Cefsulodin sodium salt hydrateSynonym : (6R,7R)-3-{methyl}-8-oxo-7-{amino}-5-thia-1-azabicyclooct-2-ene-2-carboxylate sodium salt hydrateCAS: 52152-93-9Formula: C22H19N4NaO8S2 · xH2OMolecular Weight : 554.53 (anhydrous)Alternative CAS RN : 41444-66-0 (anhy.), 62587-73-9 (acid)EC Number: 257-692-4MDL Number…
Ental genital tract infection, we document the significance of lipid A’s structure, mediated by a single bacterial enzyme, LptA, in enhancing the fitness of Neisseria gonorrhoeae. The results of these…
Product Name : 6-QuinolinecarboxaldehydeSynonym : Quinoline-6-carboxaldehydeCAS: 4113-04-6Formula: C10H7NOMolecular Weight : 157.17Alternative CAS RN : –EC Number: –MDL Number : MFCD00805836Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 2933998090Formula…
Product Name : 2-FluorothiophenolSynonym : CAS: 2557-78-0Formula: C6H5FSMolecular Weight : 128.17Alternative CAS RN : –EC Number: –MDL Number : MFCD00041419Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Medronic…
Product Name : 2-BromopyrimidineSynonym : CAS: 4595-60-2Formula: C4H3BrN2Molecular Weight : 158.99Alternative CAS RN : –EC Number: 224-993-7MDL Number : MFCD00014601Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy1228675-18-0…
Product Name : Sodium metavanadateSynonym : Sodium (meta)vanadate; Sodium trioxovanadate; Sodium vanadate(V); Sodium vanadium oxide; Sodium vanadium trioxide; Sodium vanadate (meta)CAS: 13718-26-8Formula: NaO3VMolecular Weight : 121.93Alternative CAS RN : –EC…
Product Name : Ramage Linker, Fmoc SuberolSynonym : CAS: 212783-75-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : IsatinSynonym : 2,3-Dioxo-2,3-dihydroindole; 2,3-Dioxoindoline; 2,3-Indolinedione; o-Aminobenzoylformic anhydride; Isatic acid lactam; Isatine; Isatinic acid anhydride; NSC 9262; 2,3-Diketoindoline; Indole-2,3-dioneCAS: 91-56-5Formula: C8H5NO2Molecular Weight : 147.13Alternative CAS RN : –EC…
Product Name : 2,5-Dimethylphenylboronic acidSynonym : CAS: 85199-06-0Formula: C8H11BO2Molecular Weight : 149.99Alternative CAS RN : –EC Number: –MDL Number : MFCD01863525Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : (+/-)-2-Azabicyclo(2.2.1)hept-5-en-3-oneSynonym : CAS: 49805-30-3Formula: C6H7NOMolecular Weight : 109.13Alternative CAS RN : –EC Number: 421-830-3MDL Number : MFCD00213364Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3-Amino-1-methylcyclobutan-1-ol…
Product Name : Methyl 2,3,4-tri-O-benzyl-6-O-tert-butyldiphenylsilyl-a-D-glucopyranosideSynonym : CAS: 58479-67-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-HydroxyindazoleSynonym : 3-Hydroxy-1H-indazoleCAS: 7364-25-2Formula: C7H6N2OMolecular Weight : 134.14Alternative CAS RN : –EC Number: 230-904-2MDL Number : MFCD00005685Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293399801256822-12-4…
Product Name : 2-Bromo-5-nitrobenzotrifluorideSynonym : CAS: 367-67-9Formula: C7H3BrF3NO2Molecular Weight : 270.01Alternative CAS RN : –EC Number: –MDL Number : MFCD00014707Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 2-Bromo-1-indanolSynonym : CAS: 5400-80-6Formula: C9H9BrOMolecular Weight : 213.08Alternative CAS RN : –EC Number: 226-442-6MDL Number : MFCD00003798Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290629002,6-Pyridinedicarboxaldehyde…
Product Name : 1,3-Bis(2-isocyanatopropan-2-yl)benzeneSynonym : CAS: 2778-42-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29291000Formula…
Product Name : HexafluorobenzeneSynonym : CAS: 392-56-3Formula: C6F6Molecular Weight : 186.06Alternative CAS RN : –EC Number: 206-876-2MDL Number : MFCD00000288Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 2903999075266-38-5…
Product Name : HexamethyldisilazaneSynonym : HMDS; Bis(trimethylsilyl)amineCAS: 999-97-3Formula: C6H19NSi2Molecular Weight : 161.40Alternative CAS RN : –EC Number: 213-668-5MDL Number : MFCD00008259Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-Bromo-p-xyleneSynonym : CAS: 553-94-6Formula: C8H9BrMolecular Weight : 185.07Alternative CAS RN : –EC Number: 209-055-7MDL Number : MFCD00000074Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29039990Formula…
Product Name : 2-Amino-5-bromo-4-picolineSynonym : 2-Amino-5-bromo-4-methylpyridineCAS: 98198-48-2Formula: C6H7BrN2Molecular Weight : 187.04Alternative CAS RN : –EC Number: –MDL Number : MFCD03427660Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29333999904-Chloropyrimidine-2-carbonitrile…
Product Name : Di-p-toluoyl-L-tartaric acidSynonym : (−)-O,O′-Di-p-toluoyl-L-tartaric acid; (-)-O,O′-Di-p-toluoyl-L-tartaric acid; (-)-Di-p-toluoyl-L-tartaric acid; L-(-)-DTTA; Di-p-toluyl-L-tartaric acid; (2R,3R)-(-)-Di-O-4-toluoyl-L-tartaric acid; (R(R*,R*))-2,3-Bis-succinic acid; O,O’-Di-p-toluoyl-lg-tartaric acid; (2R,3R)-(-)-Di-O-4-toluoyltartaric acidCAS: 32634-66-5Formula: C20H18O8Molecular Weight : 386.36Alternative CAS RN…
Product Name : Geranyl b-D-glucosideSynonym : CAS: 22850-13-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Methyl-1,4-benzoquinoneSynonym : CAS: 553-97-9Formula: C7H6O2Molecular Weight : 122.12Alternative CAS RN : –EC Number: 209-056-2MDL Number : MFCD00001603Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29146990(2-Cyclopropylpyridin-4-yl)boronic…
Product Name : Bay u9773Synonym : 6(R)-(4-Carboxyphenylthio)-5(S)-hydroxy-7(E);9(E);11(E);14(Z)-eicosatetraenoic acidCAS: 134733-55-4Formula: C27H36O5SMolecular Weight : 472.64Alternative CAS RN : –EC Number: –MDL Number : MFCD00898723Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 2-Chloro-5-cyanophenylboronic acidSynonym : CAS: 936249-33-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-MercaptoimidazoleSynonym : CAS: 872-35-5Formula: C3H4N2SMolecular Weight : 100.14Alternative CAS RN : –EC Number: 212-823-4MDL Number : MFCD00005188Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29332990Price…
Product Name : 2-Bromobenzyl alcoholSynonym : CAS: 18982-54-2Formula: C7H7BrOMolecular Weight : 187.04Alternative CAS RN : –EC Number: 242-719-4MDL Number : MFCD00004600Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Tetrahydrocyclopent(b)indoleSynonym : CAS: 2047-91-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Spiroheptane-2-carboxylic…
Product Name : Ethyl propiolateSynonym : CAS: 623-47-2Formula: C5H6O2Molecular Weight : 98.10Alternative CAS RN : –EC Number: 210-795-8MDL Number : MFCD00009184Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Fluoro-4-hydroxybenzonitrile (4-Cyano-3-fluorophenol)Synonym : CAS: 82380-18-5Formula: C7H4FNOMolecular Weight : 137.11Alternative CAS RN : –EC Number: 422-810-7MDL Number : MFCD00192177Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,3-DiphenylcyclopropenoneSynonym : CAS: 886-38-4Formula: C15H10OMolecular Weight : 206.24Alternative CAS RN : –EC Number: 212-948-4MDL Number : MFCD00001311Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 2914390090Buy4-Acetylbenzaldehyde…
Product Name : Arecaidine propargyl ester hydrobromideSynonym : 1-Methyl-1,2,5,6-tetrahydro-3-pyridine carboxylic acid propargyl ester hydrobromide; APECAS: 116511-28-5Formula: C10H13NO2 · HBrMolecular Weight : 260.13Alternative CAS RN : –EC Number: –MDL Number :…
Product Name : 3,4,5-TrichloropyridineSynonym : CAS: 33216-52-3Formula: C5H2Cl3NMolecular Weight : 182.44Alternative CAS RN : –EC Number: –MDL Number : MFCD00051685Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3,6-Dichloro-1,2,4,5-tetrazine…
Product Name : 2-Chloro-3,5-di(trifluoromethyl)nitrobenzeneSynonym : CAS: 654-55-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy2-(4-Ethynylphenyl)acetic…
Product Name : Lacto-N-difucopentaose ISynonym : CAS: 221224-60-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,4-Dichloro-5-fluoroacetophenoneSynonym : CAS: 704-10-9Formula: C8H5Cl2FOMolecular Weight : 207.03Alternative CAS RN : –EC Number: –MDL Number : MFCD00077499Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –5-Amino-2-(4-aminophenyl)benzimidazole…
Product Name : Diethylene glycol monohexyl etherSynonym : 2-(2-Hexyloxyethoxy)ethanol; C6E2; HexyldiglycolCAS: 112-59-4Formula: C10H22O3Molecular Weight : 190.28Alternative CAS RN : –EC Number: 203-988-3MDL Number : MFCD00010703Storage Temperature : –Shipping Temperature :…
Product Name : p-CresolSynonym : 4-MethylphenolCAS: 106-44-5Formula: C7H8OMolecular Weight : 108.14Alternative CAS RN : –EC Number: 203-398-6MDL Number : MFCD00002376Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29071200Eugenol…
Product Name : 4-Bromo-n-butylbenzeneSynonym : CAS: 41492-05-1Formula: C10H13BrMolecular Weight : 213.12Alternative CAS RN : –EC Number: –MDL Number : MFCD00040934Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –623583-09-5…
Product Name : (-)-CatechinSynonym : (−)-trans-3,3′,4′,5,7-Pentahydroxyflavane; (2S,3R)-2-(3,4-Dihydroxyphenyl)-3,4-dihydro-1(2H)-benzopyran-3,5,7-triolCAS: 18829-70-4Formula: C15H14O6Molecular Weight : 290.27Alternative CAS RN : –EC Number: 242-611-7MDL Number : MFCD00135997Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Fura 2 pentapotassium saltSynonym : CAS: 113694-64-7Formula: C29H22N3Na5O14Molecular Weight : 751.45Alternative CAS RN : –EC Number: –MDL Number : MFCD00083328Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised…
Product Name : Pyridinium dichromateSynonym : CAS: 20039-37-6Formula: C10H12Cr2N2O7Molecular Weight : 376.21Alternative CAS RN : –EC Number: 243-478-8MDL Number : MFCD00013105Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Cyano-2-fluoro-6-picoline (5-Cyano-2-fluoro-6-methylpyridine)Synonym : CAS: 375368-85-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Cholecystokinin Fragment 30-33 AmideSynonym : CCK-4; Gastrin Tetrapeptide; Tetragastrin hydrochloride; Trp-Met-Asp-Phe amideCAS: 1947-37-1Formula: C29H36N6O6SMolecular Weight : 596.70Alternative CAS RN : –EC Number: –MDL Number : MFCD00076492Storage Temperature…
Product Name : 2,4:3,5-Di-O-benzylidene-aldehydo-D-ribose hydrateSynonym : CAS: 32580-00-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Hydroxyzine dihydrochlorideSynonym : 2--1-piperazinyl]ethoxy]ethanol dihydrochloride; AtaraxCAS: 2192-20-3Formula: C21H27ClN2O2 · 2HClMolecular Weight : 447.83Alternative CAS RN : 68-88-2 (free base)EC Number: 218-586-3MDL Number : MFCD00058200Storage Temperature : +20°CShipping…
Product Name : Methyl 3-trifluoromethylbenzoateSynonym : CAS: 2557-13-3Formula: C9H7F3O2Molecular Weight : 204.15Alternative CAS RN : –EC Number: –MDL Number : MFCD00043543Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-ChlorophenolSynonym : CAS: 106-48-9Formula: C6H5ClOMolecular Weight : 128.56Alternative CAS RN : –EC Number: 203-402-6MDL Number : MFCD00002318Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29081900(E)-But-2-ene-1,4-diol…
Product Name : BAY R3401Synonym : 4-(2-Chlorophenyl)-1-ethyl-2-methyl-5-oxo-1,4,5,7-tetrahydrofuropyridine-3-carboxylic acid isopropyl esterCAS: 100276-03-7Formula: C20H22ClNO4Molecular Weight : 375.85Alternative CAS RN : –EC Number: –MDL Number : MFCD08705409Storage Temperature : +4°CShipping Temperature : –Harmonised…
Product Name : Sodium perborate tetrahydrateSynonym : CAS: 10486-00-7Formula: NaBO3 · 4H2OMolecular Weight : 153.86Alternative CAS RN : –EC Number: 239-172-9MDL Number : MFCD00149231Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 4-Amino-N,N-diethylanilineSynonym : 4-Amino-N,N-diethylanilineCAS: 93-05-0Formula: C10H16N2Molecular Weight : 164.25Alternative CAS RN : –EC Number: 202-214-1MDL Number : –Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code : 292151901212086-74-2…
Product Name : 6-EthoxypurineSynonym : CAS: 17861-06-2Formula: C7H8N4OMolecular Weight : 164.16Alternative CAS RN : –EC Number: 241-813-2MDL Number : MFCD00055973Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy1338377-73-3…
Product Name : 5-Glucopyranosyloxy-3′,4′,7-trihydroxyneoflavoneSynonym : CAS: 116329-89-6Formula: C21H20O11Molecular Weight : 448.38Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Heparin disaccharide IV-HSynonym : α-ΔUA--GlcNCAS: 123228-39-7Formula: C12H19NO10Molecular Weight : 337.28Alternative CAS RN : –EC Number: –MDL Number : MFCD00166787Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 6-Methyl-5-hepten-2-olSynonym : CAS: 1569-60-4Formula: C8H16OMolecular Weight : 128.22Alternative CAS RN : –EC Number: 216-377-1MDL Number : MFCD00004561Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29052990XantPhos…
Product Name : 4,5-Dibromo-1H-1,2,3-triazoleSynonym : CAS: 15294-81-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy1-Cyclohexyl-2,2,2-trifluoroethan-1-ol…
Product Name : Nitric acidSynonym : CAS: 7697-37-2Formula: HNO3Molecular Weight : 63.01Alternative CAS RN : –EC Number: 231-714-2MDL Number : MFCD00011349Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Acid Violet 43Synonym : CAS: 4430-18-6Formula: C21H14NNaO6SMolecular Weight : 431.39Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : DL-DihydrosphingosineSynonym : 1,3-Dihydroxy-2-aminooctadecane; DL-1,3-Dihydroxy-2-aminooctadecaneCAS: 13552-09-5Formula: C18H39NO2Molecular Weight : 301.51Alternative CAS RN : –EC Number: 236-933-7MDL Number : MFCD00051176Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-FluoroanilineSynonym : CAS: 348-54-9Formula: C6H6FNMolecular Weight : 111.12Alternative CAS RN : –EC Number: 206-478-9MDL Number : MFCD00007642Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29214200Buy2-Bromo-6-chloronicotinaldehyde…
Product Name : Carbethoxymethyltriphenylphosphonium bromideSynonym : CAS: 1530-45-6Formula: CH3CH2O2CCH2P(C6H5)3BrMolecular Weight : 429.30Alternative CAS RN : –EC Number: 216-230-1MDL Number : MFCD00011835Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 7-MethylindoleSynonym : CAS: 933-67-5Formula: C9H9NMolecular Weight : 131.18Alternative CAS RN : –EC Number: 213-270-1MDL Number : MFCD00005684Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29339980Formula…
Product Name : 4-(Trifluoromethyl)phenyl isothiocyanateSynonym : CAS: 1645-65-4Formula: C8H4F3NSMolecular Weight : 203.19Alternative CAS RN : –EC Number: –MDL Number : MFCD00039645Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3,5-DifluoronitrobenzeneSynonym : 1,3-Difluoro-5-nitrobenzeneCAS: 2265-94-3Formula: C6H3F2NO2Molecular Weight : 159.09Alternative CAS RN : –EC Number: 218-867-0MDL Number : MFCD00012142Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29049095900Formula…
Product Name : Acetylethylcholine mustard hydrochlorideSynonym : Acetyl AF-64CAS: 103994-00-9Formula: C8H16ClNO2 · HClMolecular Weight : 230.13Alternative CAS RN : –EC Number: –MDL Number : MFCD00055153Storage Temperature : –Shipping Temperature :…
Product Name : 4-Methoxyphenyl 3-O-allyl-2,4,6-tri-O-benzyl-β-D-galactopyranosideSynonym : CAS: 247027-78-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : ChlorothiazideSynonym : 6-Chloro-2H-1,2,4-benzothiadiazine-7-sulfonamide 1,1-dioxideCAS: 58-94-6Formula: C7H6ClN3O4S2Molecular Weight : 295.72Alternative CAS RN : –EC Number: 200-404-9MDL Number : MFCD00058576Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 5-(Hydroxymethyl)furfural, 99%Synonym : CAS: 67-47-0Formula: C6H6O3Molecular Weight : 126.11Alternative CAS RN : –EC Number: 200-654-9MDL Number : MFCD00003234Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : DL-3-Hydroxy-3-methylglutaryl coenzyme A sodium salt hydrateSynonym : HMG-CoACAS: 103476-21-7Formula: C27H42N7Na2O20P3S · xH2OMolecular Weight : 955.62 (anhydrous)Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature :…
Vement of those molecules as intracellular signalling partners mediating KATP channel stimulation downstream of NO (induction). It can be vital to ascertain how ERK1/2 and CaMKII are positioned relative to…
Product Name : CarboxytolbutamideSynonym : N-Butyl-N´-(4-carboxyphenylsulfonyl)ureaCAS: 2224-10-4Formula: C12H16N2O5SMolecular Weight : 300.33Alternative CAS RN : –EC Number: –MDL Number : MFCD00272697Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 29359090992-(Tributylstannyl)thiophene…
Product Name : 8-Aminonaphthalene-1,6-disulfonic acidSynonym : Amino-Epsilon acid; 8-Amino-1,6-naphthalene disulfonic acid sodium saltCAS: 129-91-9Formula: C10H9NO6S2Molecular Weight : 303.31Alternative CAS RN : –EC Number: 204-969-2MDL Number : MFCD00021548Storage Temperature : +20°CShipping…
Product Name : 5-Bromopyridine-2-carboxylic acidSynonym : CAS: 30766-11-1Formula: C6H4B2NO2Molecular Weight : 202.01Alternative CAS RN : –EC Number: –MDL Number : MFCD00234149Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 3,4-DimethylthiophenolSynonym : CAS: 18800-53-8Formula: C8H10SMolecular Weight : 138.23Alternative CAS RN : –EC Number: 242-587-8MDL Number : MFCD00010023Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Azido-C6-OH…
Product Name : Potassium ferricyanideSynonym : Potassium ferricyanide; Red prussiate; Potassium hexacyanoferrate(III)CAS: 13746-66-2Formula: C6FeK3N6Molecular Weight : 329.26Alternative CAS RN : –EC Number: 237-323-3MDL Number : MFCD00011392Storage Temperature : +20°CShipping Temperature…
Product Name : 2,3,4-Trifluorophenylboronic acidSynonym : CAS: 226396-32-3Formula: C6H4BF3O2Molecular Weight : 175.90Alternative CAS RN : –EC Number: –MDL Number : MFCD01863168Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Mercapto-5-methylbenzimidazoleSynonym : CAS: 27231-36-3Formula: C8H8N2SMolecular Weight : 164.23Alternative CAS RN : –EC Number: 248-350-5MDL Number : MFCD00010617Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293399808-Chloro-2-methyl-1,5-naphthyridine…
Product Name : Cetyltrimethylammonium p-toluene sulfonateSynonym : Cetyltrimethylammonium p-toluenesulfonateCAS: 138-32-9Formula: C26H49NO3SMolecular Weight : 455.74Alternative CAS RN : –EC Number: 205-324-8MDL Number : MFCD00061383Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 3”,4”-DihydroxyacetophenoneSynonym : CAS: 1197-09-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Imino(methyl)(phenyl)-l6-sulfanone…
Product Name : A-85783Synonym : (R)-6-(4-Fluorophenyl)-N,N-dimethyl-3-thiazol-7-yl]carbonyl-1H-indole-1-carboxamideCAS: 161395-33-1Formula: C29H23FN4O2SMolecular Weight : 510.58Alternative CAS RN : –EC Number: –MDL Number : MFCD00935061Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Methyl 2-O-(a-D-mannopyranosyl)-a-D-mannopyranosideSynonym : CAS: 59571-75-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : L-Tartaric acidSynonym : (2R,3R)-(+)-Tartaric acid; L-Threaric acid; Acidum tartaricum; (2R,3R)-2,3-Dihydroxybutanedioic acidCAS: 87-69-4Formula: C4H6O6Molecular Weight : 150.09Alternative CAS RN : –EC Number: 201-766-0MDL Number : MFCD00064207Storage Temperature :…
Product Name : 5-Methoxyindole-3-carboxaldehydeSynonym : CAS: 10601-19-1Formula: C10H9NO2Molecular Weight : 175.19Alternative CAS RN : –EC Number: 234-220-5MDL Number : MFCD00005623Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29339980Cyclobut-1-enecarboxylic…
Product Name : 2-Amino-3-cyano-5-methylthiopheneSynonym : CAS: 4623-55-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –(3,5-Difluoropyridin-2-yl)methanol…
Product Name : 2,3-Dihydroxybenzaldehyde, 97%Synonym : CAS: 24677-78-9Formula: C7H6O3Molecular Weight : 138.12Alternative CAS RN : –EC Number: 246-398-1MDL Number : MFCD00003324Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Bis-(4-fluorophenyl)-methanolSynonym : CAS: 365-24-2Formula: C13H10F2OMolecular Weight : 220.22Alternative CAS RN : –EC Number: 206-671-8MDL Number : MFCD00000357Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290629003-Bromo-4-methylpyridin-2-ol…
Product Name : NU6027Synonym : 4-Cyclohexylmethoxy-2,6-diamino-5-nitrosopyrimidineCAS: 220036-08-8Formula: C11H17N5O2Molecular Weight : 251.28Alternative CAS RN : –EC Number: –MDL Number : MFCD05664735Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Platinum nitrateSynonym : CAS: 18496-40-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Nitrobenzimidazole nitrateSynonym : CAS: 27896-84-0Formula: C7H5N3O2 · HNO3Molecular Weight : 226.15Alternative CAS RN : –EC Number: 248-716-4MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : GuaiacolSynonym : 2-Methoxyphenol; Catechol monomethyl ether; Pyrocatechol monomethyl etherCAS: 90-05-1Formula: C7H8O2Molecular Weight : 124.14Alternative CAS RN : –EC Number: 201-964-7MDL Number : MFCD00002185Storage Temperature : +20°CShipping Temperature…
Product Name : 4-Methylphenyl 4-O-benzyl-1-thio-α-L-rhamnopyranosideSynonym : CAS: 1053179-22-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Amino-N-quinolin-8-yl-benzenesulfonamideSynonym : QBSCAS: 16082-64-7Formula: C15H13N3O2SMolecular Weight : 299.35Alternative CAS RN : –EC Number: –MDL Number : MFCD00168987Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1251005-61-4…
Product Name : Adenosine 3′,5′-cyclic monophosphate tris saltSynonym : cAMP; cyclic AMPCAS: 102029-77-6Formula: C10H12N5O6P · C4H11NO3Molecular Weight : 450.34Alternative CAS RN : –EC Number: –MDL Number : MFCD00058346Storage Temperature :…
Product Name : Stearyl oleateSynonym : Oleic acid stearyl esterCAS: 17673-49-3Formula: C36H70O2Molecular Weight : 534.94Alternative CAS RN : –EC Number: 241-651-2MDL Number : MFCD00056227Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : PD 169316Synonym : 4-(4-Fluorophenyl)-2-(4-nitrophenyl)-5-(4-pyridyl)-1H-imidazoleCAS: 152121-53-4Formula: C20H13FN4O2Molecular Weight : 360.34Alternative CAS RN : –EC Number: –MDL Number : MFCD12405019Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 3,5-DimethoxyphenolSynonym : CAS: 500-99-2Formula: C8H10O3Molecular Weight : 154.16Alternative CAS RN : –EC Number: 207-917-7MDL Number : MFCD00008388Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Imidazopyridine-8-carbaldehyde…
Product Name : Diethylamine hydrochlorideSynonym : Diethylammonium chlorideCAS: 660-68-4Formula: C4H11N · HClMolecular Weight : 109.60Alternative CAS RN : –EC Number: 211-541-9MDL Number : MFCD00012499Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 4-Chlorophenylboronic acidSynonym : CAS: 1679-18-1Formula: C6H6BClO2Molecular Weight : 156.38Alternative CAS RN : –EC Number: 216-845-5MDL Number : MFCD00039137Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : SphingosylphosphorylcholineSynonym : (2S,3R,4E)-2-Amino-4-octadecene-3-hydroxy-1-phosphocholine; 2-hydroxy-phosphinyl]oxy]-N,N,N-trimethylethanaminium inner salt; D-erythro-Sphingosine phosphocholine; Lyso SM (d18:1); LysosphingomyelinCAS: 1670-26-4Formula: C23H49N2O5PMolecular Weight : 464.62Alternative CAS RN : –EC Number: –MDL Number : MFCD02259287Storage Temperature…
Product Name : 5-(N,N-Hexamethylene)amilorideSynonym : HMACAS: 1428-95-1Formula: C12H18ClN7OMolecular Weight : 311.77Alternative CAS RN : –EC Number: –MDL Number : MFCD00069211Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –5-Methyl-1H-indazol-4-ol…
Product Name : Methyl-β-D-galactopyranosideSynonym : Methyl β-D-galactosideCAS: 1824-94-8Formula: C7H14O6Molecular Weight : 194.18Alternative CAS RN : –EC Number: 217-361-7MDL Number : MFCD00064357Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Bromopyridine-6-carboxaldehydeSynonym : CAS: 34160-40-2Formula: C6H4BrNOMolecular Weight : 186.01Alternative CAS RN : –EC Number: –MDL Number : MFCD02683546Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –958358-00-4…
Product Name : Manganese(II) sulfate monohydrateSynonym : Manganese sulfate monohydrateCAS: 10034-96-5Formula: MnSO4 · H2OMolecular Weight : 169.02Alternative CAS RN : 7785-87-7EC Number: 232-089-9MDL Number : MFCD00149159Storage Temperature : +20°CShipping Temperature…
Product Name : Sodium bisulfiteSynonym : Sodium hydrogen sulfite; E222; E 222; Sodium bisulphiteCAS: 7631-90-5Formula: HNaO3SMolecular Weight : 104.06Alternative CAS RN : –EC Number: 231-548-0MDL Number : MFCD00003530Storage Temperature :…
Product Name : Indole-3-butyric acidSynonym : 4-(3-Indolyl)butyric acid; 4-(3-Indolyl)butanoic acid; IBACAS: 133-32-4Formula: C12H13NO2Molecular Weight : 203.24Alternative CAS RN : –EC Number: 205-101-5MDL Number : MFCD00005664Storage Temperature : +20°CShipping Temperature :…
Product Name : Phosphoric acid 75%Synonym : Orthophosphoric acid; Phosphoric acid solutionCAS: 7664-38-2Formula: H3O4PMolecular Weight : 98.00Alternative CAS RN : –EC Number: 231-633-2MDL Number : MFCD00011340Storage Temperature : +20°CShipping Temperature…
Ined how Kir6.2/SUR2A (i.e. ventricular-type KATP ) channels transiently expressed in HEK293 cells respond to NO induction. Single-channel recordings were performed inside the cell-attached patch configuration to preserve integrity on…
Product Name : 5-BromoindolineSynonym : CAS: 22190-33-6Formula: C8H8BrNMolecular Weight : 198.06Alternative CAS RN : –EC Number: –MDL Number : MFCD00027410Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy1256825-86-1…
Product Name : Sodium salicylate, Ph. Pyrimidine-2-carbaldehyde manufacturer Eur. 102045-96-5 site gradeSynonym : 2-Hydroxybenzoic acid sodium salt; Sodium 2-hydroxybenzoate; Salicylic acid sodium salt; 2-hydroxybenzenecarboxylate; Natrii salicylasCAS: 54-21-7Formula: C7H5NaO3Molecular Weight :…
Product Name : 2,3,5-TribromopyridineSynonym : CAS: 75806-85-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4-Cyanobutanoic…
Product Name : 4-N,N-Diethyl-2-methyl-1,4-phenylenediamine monohydrochloride (CD-2 Developer)Synonym : CAS: 2051-79-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : N-(alpha,alpha,alpha-Trifluoro-m-tolyl)piperazineSynonym : CAS: 15532-75-9Formula: C11H13F3N2Molecular Weight : 230.23Alternative CAS RN : –EC Number: 239-574-4MDL Number : MFCD00005959Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293359952-(2-Fluoroethoxy)ethanol…
Product Name : α-Galactosyl-C18-ceramideSynonym : CAS: 148347-40-4Formula: Molecular Weight : 728.10Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Ni(COD)2…
Product Name : 4-Hydroxy-5,7-dimethoxy-3-(4”-methoxyphenyl)coumarinSynonym : CAS: 14736-59-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1-(3-Aminopropyl)azepan-2-one…
Product Name : BischloroanthrabenzoxocinoneSynonym : CAS: 866022-28-8Formula: Molecular Weight : 543.40Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Buy1H-Benzotriazole-1-carboxaldehyde…
Product Name : Saccharin sodium saltSynonym : Saccharin sodium salt hydrate; Sodium saccharin; ,3-Dihydro-3-oxobenzisosulfonazole sodium salt; 2-Sulfobenzoic acid imide sodium salt; o-Sulfobenzimide sodium salt; Saccharin soluble; 2-Sodio-1,2-benzisothiazol-3(2H)-one 1,1-dioxide; 1,2-Benzisothiazol-3(2H)-one, 1,1-dioxide,…
Product Name : Isoxazole-5-carboxylic acidSynonym : CAS: 21169-71-1Formula: C4H3NO3Molecular Weight : 113.07Alternative CAS RN : –EC Number: –MDL Number : MFCD00156151Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-NaphthylamineSynonym : α-Naphthylamine; 1-Aminonaphthalene; alpha-NaphthylamineCAS: 134-32-7Formula: C10H7NH2Molecular Weight : 143.19Alternative CAS RN : –EC Number: 205-138-7MDL Number : MFCD00004016Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : Ethyl bromodifluoroacetateSynonym : CAS: 667-27-6Formula: BrCF2CO2CH2CH3Molecular Weight : 202.99Alternative CAS RN : –EC Number: 211-567-0MDL Number : MFCD00042069Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : PD-156707Synonym : α-ethylidene]-1,3-benzodioxole-5-acetic acid sodium saltCAS: 162412-70-6Formula: C28H25O9·NaMolecular Weight : 528.48Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : –Harmonised Tariff…
Product Name : Tetramethylammonium bromideSynonym : CAS: 64-20-0Formula: C4H12BrNMolecular Weight : 154.06Alternative CAS RN : –EC Number: 200-581-2MDL Number : MFCD00011626Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : D-(+)-Melibiose, anhydrousSynonym : Melibiose; 6-O-(a-D-Galactopyranosyl)-D-glucopyranose hydrate; 6-O-(a-D-Galactopyranosyl)-D-glucopyranose monohydrate; α-D-Melibiose hydrate; 6-O-α-D-Galactopyranosyl-D-glucose; 6-α-D-Galactopyranosyl-D-glucopyranose; D-Melibiose, anhydrous; D-(+)-Melibiose anhydrous; D-Melibiose anhydrousCAS: 585-99-9Formula: C12H22O11Molecular Weight : 342.30Alternative CAS RN : 66009-10-7…
Product Name : Benzyltriphenylphosphonium iodideSynonym : CAS: 15853-35-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : DL-alpha-Monoolein, 98%Synonym : 1-(cis-9-Octadecenoyl)-rac-glycerol; rac-Glycerol 1-monooleate; DL-α-Monoolein; Glyceryl cis-9-octadecenoate; Monoolein; 1-O-Oleoyl-rac-glycerolCAS: 111-03-5Formula: C21H40O4Molecular Weight : 356.54Alternative CAS RN : –EC Number: 203-827-7MDL Number : MFCD00042735Storage Temperature :…
Product Name : 3,4-Cyclohexenoesculetin β-D-galactopyranosideSynonym : CAS: 182805-65-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Potassium nitriteSynonym : CAS: 7758-09-0Formula: KNO2Molecular Weight : 85.11Alternative CAS RN : –EC Number: 231-832-4MDL Number : MFCD00011408Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 4-ChlorobenzotrifluorideSynonym : CAS: 98-56-6Formula: C7H4ClF3Molecular Weight : 180.56Alternative CAS RN : –EC Number: 202-681-1MDL Number : MFCD00000627Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290399906-Bromochroman-4-amine…
Product Name : 2,6-Difluoro-4-xadphenoxyxadacetamideSynonym : PEPACAS: 141286-78-4Formula: C16H16N2O4S2F2Molecular Weight : 402.44Alternative CAS RN : –EC Number: –MDL Number : MFCD04974493Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –494767-19-0…
Product Name : L-701,324Synonym : 7-Chloro-4-hydroxy-3-(3-phenoxy)phenylquinolin-2-oneCAS: 142326-59-8Formula: C21H14ClNO3Molecular Weight : 363.79Alternative CAS RN : –EC Number: –MDL Number : MFCD00910917Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : ω-Conotoxin MVIIASynonym : SNX-111; ZiconotideCAS: 107452-89-1Formula: C102H172N36O32S7Molecular Weight : 2639.13Alternative CAS RN : –EC Number: –MDL Number : MFCD00145036Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 3-Phenylisoxazol-5-oneSynonym : CAS: 1076-59-1Formula: C9H7NO2Molecular Weight : 161.16Alternative CAS RN : –EC Number: 214-064-4MDL Number : MFCD00003158Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293499903-Iodooxetane…
Product Name : 2,4-DifluorobenzonitrileSynonym : CAS: 3939-09-1Formula: C7H3F2NMolecular Weight : 139.11Alternative CAS RN : –EC Number: 223-523-8MDL Number : MFCD00009826Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690957-Bromo-1H-indole-6-carbonitrile…
Product Name : BW B70CSynonym : N--1-methyl-2-propenyl]-N-hydroxyureaCAS: 134470-38-5Formula: C17H17FN2O3Molecular Weight : 316.33Alternative CAS RN : –EC Number: –MDL Number : MFCD00890868Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 5,6-Diamino-1-methyluracilSynonym : CAS: 6972-82-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Chloro-5,7-difluorobenzothiazole…
Product Name : Diethyl hydroxymethylphosphonateSynonym : CAS: 3084-40-0Formula: C5H13O4PMolecular Weight : 168.13Alternative CAS RN : –EC Number: 221-391-6MDL Number : MFCD00014418Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-PhenyldodecaneSynonym : DodecylbenzeneCAS: 123-01-3Formula: C18H30Molecular Weight : 246.44Alternative CAS RN : –EC Number: 204-591-8MDL Number : MFCD00008974Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29029000Buy2092067-90-6…
Product Name : N-Butyldeoxynojirimycin hydrochlorideSynonym : CAS: 210110-90-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Nitro-o-phenylenediamineSynonym : CAS: 99-56-9Formula: C6H7N3O2Molecular Weight : 153.14Alternative CAS RN : –EC Number: 202-766-3MDL Number : MFCD00007724Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –979-88-4…
Product Name : 2-Methyl-3-buten-2-olSynonym : 1,1-Dimethylallyl alcohol; 3-Hydroxy-3-methyl-1-buteneCAS: 115-18-4Formula: C5H10OMolecular Weight : 86.13Alternative CAS RN : –EC Number: 204-068-4MDL Number : MFCD00004470Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 1,2-HexanediolSynonym : CAS: 6920-22-5Formula: C6H14O2Molecular Weight : 118.18Alternative CAS RN : –EC Number: 230-029-6MDL Number : MFCD00010737Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290539955-Iodopyrimidine…
Product Name : Octyltrimethylammonium chlorideSynonym : CAS: 10108-86-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Methyl-2-nitroanisoleSynonym : CAS: 5345-42-6Formula: C8H9NO3Molecular Weight : 167.16Alternative CAS RN : –EC Number: 226-295-8MDL Number : MFCD00007179Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290930901-(oxolan-3-yl)ethan-1-one…
Product Name : (6-Bromopyridin-2-yl)methanolSynonym : CAS: 33674-96-3Formula: C6H6BrNOMolecular Weight : 188.02Alternative CAS RN : –EC Number: –MDL Number : MFCD04039884Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –(3R,4R)-3-Aminotetrahydro-2H-pyran-4-ol…
Product Name : 3-Phenyl-1-propylamineSynonym : γ-Aminopropylbenzene; 3-PhenylpropylamineCAS: 2038-57-5Formula: C6H5CH2CH2CH2NH2Molecular Weight : 135.21Alternative CAS RN : –EC Number: 218-012-1MDL Number : MFCD00008224Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3”,5”-DifluoroacetophenoneSynonym : CAS: 123577-99-1Formula: C8H6F2OMolecular Weight : 156.13Alternative CAS RN : –EC Number: –MDL Number : MFCD00042489Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 1,3-DiaminopropaneSynonym : 1,3-Propanediamine; DAP; TMEDA; TrimethylenediamineCAS: 109-76-2Formula: H2N(CH2)3NH2Molecular Weight : 74.13Alternative CAS RN : –EC Number: 203-702-7MDL Number : MFCD00008228Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : Dapagliflozin 3-O-β-D-glucuronideSynonym : CAS: 1351438-75-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : (1S)-(+)-Camphor-10-sulfonic acidSynonym : (+)-Camphor-10-sulfonic acid (β); (1S)-Camphor-10-sulfonic acid; (+)-10-Camphorsulfonic acidCAS: 3144-16-9Formula: C10H16O4SMolecular Weight : 232.30Alternative CAS RN : –EC Number: 221-554-1MDL Number : MFCD00064157Storage Temperature : +20°CShipping…
Product Name : 3-BromopyridineSynonym : CAS: 626-55-1Formula: C5H4BrNMolecular Weight : 158.00Alternative CAS RN : –EC Number: 210-952-0MDL Number : MFCD00006373Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29333999Potassium…
Product Name : L-NASPASynonym : N-Palmitoyl-L-serine phosphoric acidCAS: 155915-46-1Formula: C19H38NO7PMolecular Weight : 423.48Alternative CAS RN : –EC Number: –MDL Number : MFCD02684035Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 3-Chloro-4-hydroxyphenylacetic acidSynonym : CAS: 33697-81-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-PhenylbiguanideSynonym : CAS: 102-02-3Formula: C6H5NHC(=NH)NHC(=NH)NH2Molecular Weight : 177.21Alternative CAS RN : –EC Number: 202-998-5MDL Number : MFCD00179077Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292529002621932-42-9…
Product Name : TetrachlorocyclopropeneSynonym : CAS: 6262-42-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290389902,6-Bis(aminomethyl)pyridine…
Product Name : Sulfamic acidSynonym : Amidosulfonic acid; Sulphamic acidCAS: 5329-14-6Formula: H3NO3SMolecular Weight : 97.09Alternative CAS RN : –EC Number: 226-218-8MDL Number : MFCD00011603Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : Bergenin monohydrateSynonym : CAS: 108032-11-7Formula: C14H16O9 · H2OMolecular Weight : 346.29Alternative CAS RN : –EC Number: –MDL Number : MFCD00167248Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : alpha-Bromophenylacetic acidSynonym : CAS: 4870-65-9Formula: C6H5CH(Br)CO2HMolecular Weight : 215.04Alternative CAS RN : –EC Number: 225-477-4MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Succinic acid disodium salt, anhydrousSynonym : Disodium succinate; Sodium succinate dibasic; Sodium succinate anhydrous; Butanedioic acid disodium salt; Succinic acid disodium salt anhydrousCAS: 150-90-3Formula: C4H4Na2O4Molecular Weight :…
Product Name : PD-166866Synonym : 1-pyrimidin-7-yl]-3-tert-butyl ureaCAS: 192705-79-6Formula: C20H24N6O3Molecular Weight : 396.44Alternative CAS RN : –EC Number: –MDL Number : MFCD12922514Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Aminophenyl b-L-fucopyranosideSynonym : CAS: 69936-58-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,3-Diethyl-2-thioureaSynonym : N,N’-Diethylthiourea; Thiourea, N,N’-dibutyl; 1,3-Dibutylthiourea; N,N’-dibutylthioureaCAS: 105-55-5Formula: (C2H5NH)2CSMolecular Weight : 132.23Alternative CAS RN : –EC Number: 203-308-5MDL Number : MFCD00004925Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 2-Bromo-5-nitrotolueneSynonym : CAS: 7149-70-4Formula: C7H6BrNO2Molecular Weight : 216.04Alternative CAS RN : –EC Number: 230-481-4MDL Number : MFCD00007281Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Cyclohex-3-en-1-ol…
Product Name : 2-MethylpiperazineSynonym : CAS: 109-07-9Formula: C5H12N2Molecular Weight : 100.17Alternative CAS RN : –EC Number: 203-644-2MDL Number : MFCD00005954Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29335995(R)-(Piperidin-3-yl)methanol…
Product Name : MAHMA NONOateSynonym : 6-(2-Hydroxy-1-methyl-2-nitrosohydrazino)-N-methyl-1-hexanamine; NOC-9CAS: 146724-86-9Formula: C8H20N4O2Molecular Weight : 204.27Alternative CAS RN : –EC Number: –MDL Number : MFCD01310509Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : BetrixabanSynonym : CAS: 330942-05-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 2,5-DifluorobenzamideSynonym : CAS: 85118-03-2Formula: C7H5F2NOMolecular Weight : 157.12Alternative CAS RN : –EC Number: 285-655-2MDL Number : MFCD00015548Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292429981398496-40-6…
Product Name : Copper(II) trifluoromethanesulfonateSynonym : CAS: 34946-82-2Formula: Cu(CF3SO3)2Molecular Weight : 361.68Alternative CAS RN : –EC Number: 252-300-8MDL Number : MFCD00077492Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Ethyl-2-oxo-4-phenylbutyrateSynonym : CAS: 64920-29-2Formula: C12H14O3Molecular Weight : 206.24Alternative CAS RN : –EC Number: 265-276-9MDL Number : MFCD00037533Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 291830005-Bromo-1H-imidazole-2-carboxylic…
Product Name : 1,2:3,4-Di-O-isopropylidene-6-deoxy-6-azido-α-D-galactopyranoseSynonym : CAS: 4711-00-6Formula: Molecular Weight : 285.30Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 2-Acetylbenzoic acidSynonym : CAS: 577-56-0Formula: C9H8O3Molecular Weight : 164.16Alternative CAS RN : –EC Number: 209-413-2MDL Number : MFCD00002475Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Binucleine 2Synonym : N′-(1-(3-Chloro-4-fluorophenyl)-4-cyano-1H-pyrazol-5-yl)-N,N-dimethyliminoformamideCAS: 220088-42-6Formula: C13H11N5ClFMolecular Weight : 291.71Alternative CAS RN : –EC Number: –MDL Number : MFCD00177827Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : D-(+)-Malic acidSynonym : CAS: 636-61-3Formula: C4H6O5Molecular Weight : 134.09Alternative CAS RN : –EC Number: 211-262-2MDL Number : MFCD00004245Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-HydroxybenzhydrazideSynonym : CAS: 936-02-7Formula: C7H8N2O2Molecular Weight : 152.15Alternative CAS RN : –EC Number: 213-311-3MDL Number : MFCD00007599Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292800902-Bromo-5-formylbenzoic…
Product Name : Ethyl oleateSynonym : Ethylis oleas; Oleic acid ethyl esterCAS: 111-62-6Formula: C20H38O2Molecular Weight : 310.53Alternative CAS RN : –EC Number: 203-889-5MDL Number : MFCD00009579Storage Temperature : +20°CShipping Temperature…
Product Name : 3,4-DinitroanilineSynonym : CAS: 610-41-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1049730-42-8…
Product Name : 2,3-DiaminonaphthaleneSynonym : 2,3-NaphthalenediamineCAS: 771-97-1Formula: C10H10N2Molecular Weight : 158.20Alternative CAS RN : –EC Number: 212-241-0MDL Number : MFCD00004116Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29215990Cholic…
Product Name : 9-Fluoreneacetic acidSynonym : 9-Fluorenylacetic acidCAS: 6284-80-6Formula: C15H12O2Molecular Weight : 224.26Alternative CAS RN : –EC Number: –MDL Number : MFCD00013262Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 2-NitrophenolSynonym : CAS: 88-75-5Formula: C6H5NO3Molecular Weight : 139.11Alternative CAS RN : –EC Number: 201-857-5MDL Number : MFCD00011688Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 2908990077545-45-0…
Product Name : 2-AminopyridineSynonym : CAS: 504-29-0Formula: C5H6N2Molecular Weight : 94.12Alternative CAS RN : –EC Number: 207-988-4MDL Number : MFCD00006312Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293339994-Methoxycarbonyl-3-methyl-benzoicacid…
Product Name : Methyl glyoxylateSynonym : CAS: 922-68-9Formula: C3H4O3Molecular Weight : 88.1Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Protoporphyrin IX dimethyl esterSynonym : Dimethyl 8,13-divinyl-3,7,12,17-tetramethyl-21H,23H-porphine-2,18-dipropionate; Ooporpyhrin dimethyl esterCAS: 5522-66-7Formula: C36H38N4O4Molecular Weight : 590.71Alternative CAS RN : –EC Number: 226-870-3MDL Number : MFCD00064531Storage Temperature : –Shipping…
Product Name : 4-Chloro-2-cyclopentylphenyl-β-D-galactopyranosideSynonym : CAS: 24718-43-2Formula: Molecular Weight : 358.81Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyMethyl…
Product Name : Benzyl salicylateSynonym : Benzyl 2-hydroxybenzoate; 2-Hydroxybenzoic acid benzyl ester; Salicylic acid benzyl ester; Benzyl o-hydroxybenzoate; Phenylmethyl 2-hydroxybenzoate; Salicylic acid, benzyl esterCAS: 118-58-1Formula: C14H12O3Molecular Weight : 228.25Alternative CAS…
Product Name : 2-Hydroxy-6-trifluoromethylpyridineSynonym : CAS: 34486-06-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 1-Ethynyl-1-cyclohexanolSynonym : CAS: 78-27-3Formula: C8H12OMolecular Weight : 124.18Alternative CAS RN : –EC Number: 201-100-9MDL Number : MFCD00003858Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 290619002017188-77-9…
Product Name : TemsirolimusSynonym : 42-heptane Chemical name Price of 2-Hydroxyethyl methacrylate Headquartered in New Jersey, USA, ChemScence is a global leading manufacturer and supplier of building blocks and
Product Name : 5-Amino-4-carbethoxy-1-phenylpyrazoleSynonym : CAS: 16078-71-0Formula: C12H13N3O2Molecular Weight : 231.26Alternative CAS RN : –EC Number: 240-224-8MDL Number : MFCD00020731Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Ethoxycarbonyl isothiocyanateSynonym : CAS: 16182-04-0Formula: C4H5NO2SMolecular Weight : 131.15Alternative CAS RN : –EC Number: 240-318-9MDL Number : MFCD00004814Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Chloro-4-fluorophenylboronic acidSynonym : CAS: 144432-85-9Formula: C6H5BClFO2Molecular Weight : 174.37Alternative CAS RN : –EC Number: –MDL Number : MFCD00051800Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Methyl-3-nitrophenylboronic acidSynonym : CAS: 100960-11-0Formula: C7H8BNO4Molecular Weight : 180.96Alternative CAS RN : –EC Number: –MDL Number : MFCD00757435Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Ammonium cerium(IV) nitrateSynonym : CAS: 16774-21-3Formula: H8CeN8O18Molecular Weight : 548.23Alternative CAS RN : –EC Number: 240-827-6MDL Number : MFCD00151121Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : Octyl 2,3,4,6-tetra-O-acetyl-b-D-glucopyranosideSynonym : 1-O-Octyl-β-D-glucopyranoside 2,3,4,6-tetraacetate; 1-O-Octyl-beta-D-glucopyranoside 2,3,4,6-tetraacetateCAS: 38954-67-5Formula: C22H36O10Molecular Weight : 460.52Alternative CAS RN : –EC Number: –MDL Number : MFCD00192368Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : Ethylene glycolSynonym : 1,2-Ethanediol; Ethane-1,2-diol; MEG; Mono Ethylene Glycol; Monoethylene GlycolCAS: 107-21-1Formula: C2H6O2Molecular Weight : 62.07Alternative CAS RN : –EC Number: 203-473-3MDL Number : MFCD00002885Storage Temperature :…
Product Name : 2-Bromopyridine-4-carboxaldehydeSynonym : CAS: 118289-17-1Formula: C6H4BrNOMolecular Weight : 186.01Alternative CAS RN : –EC Number: –MDL Number : MFCD04039311Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –737007-45-3…
Product Name : Palmityl dodecanoateSynonym : Dodecanoic acid hexadecanyl ester; Lauric acid palmityl ester; Palmityl laurateCAS: 20834-06-4Formula: C28H56O2Molecular Weight : 424.74Alternative CAS RN : –EC Number: 244-071-8MDL Number : MFCD00056216Storage…
Product Name : 2,5-Pyridinedicarboxylic acidSynonym : CAS: 100-26-5Formula: C7H5NO4Molecular Weight : 167.12Alternative CAS RN : –EC Number: 202-834-2MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : FidarestatSynonym : CAS: 136087-85-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 2934999077215-54-4…
Product Name : 6-Chloro-3-methyluracilSynonym : CAS: 4318-56-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4-Phenylpyridin-2-ol…
Product Name : (S)-(+)-Nipecotic acidSynonym : CAS: 59045-82-8Formula: C6H11NO2Molecular Weight : 129.16Alternative CAS RN : –EC Number: –MDL Number : MFCD01630807Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,2,3,4-TetrafluorobenzeneSynonym : CAS: 551-62-2Formula: C6H2F4Molecular Weight : 150.07Alternative CAS RN : –EC Number: 208-997-6MDL Number : MFCD00000285Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29039990207591-86-4…
Product Name : NGB 2904 hydrochlorideSynonym : N-butyl]-9H-fluorene-2-carboxamide hydrochlorideCAS: 189061-11-8Formula: C28H29Cl2N3O·HClMolecular Weight : 530.92Alternative CAS RN : –EC Number: –MDL Number : MFCD09971107Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff…
Product Name : Cyclohexane, 99%Synonym : CAS: 110-82-7Formula: C6H12Molecular Weight : 84.16Alternative CAS RN : –EC Number: 203-806-2MDL Number : MFCD00003814Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Glutaryl coenzyme A lithium saltSynonym : Glutaryl CoACAS: 103192-48-9Formula: C26H42N7O19P3SMolecular Weight : 881.63Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature :…
Product Name : Ethyl 3-O-benzyl-2-O-levulinoyl-6-O-trityl-1-thio-β-D-glucopyranosideSynonym : CAS: Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Methoxyphenylboronic acidSynonym : CAS: 5720-06-9Formula: C7H9BO3Molecular Weight : 151.96Alternative CAS RN : –EC Number: –MDL Number : MFCD00236047Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Methanesulfonic acid sodium saltSynonym : Sodium methanesulfonateCAS: 2386-57-4Formula: CH3NaO3SMolecular Weight : 118.09Alternative CAS RN : –EC Number: 219-203-2MDL Number : MFCD00064389Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…
Product Name : 7,8-BenzoquinolineSynonym : CAS: 230-27-3Formula: C13H9NMolecular Weight : 179.22Alternative CAS RN : –EC Number: 205-937-0MDL Number : MFCD00004984Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29339980152120-54-2…
Product Name : 2-NaphthaleneethanolSynonym : CAS: 1485-07-0Formula: C10H7CH2CH2OHMolecular Weight : 172.22Alternative CAS RN : –EC Number: 216-061-3MDL Number : MFCD00004128Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29062900278183-12-3…
Product Name : Pituitary adenylate cyclase activating polypeptide-27 ovineSynonym : PACAP-27CAS: 127317-03-7Formula: C142H224N40O39SMolecular Weight : 3147.64Alternative CAS RN : –EC Number: –MDL Number : MFCD00167418Storage Temperature : -20°CShipping Temperature :…
Product Name : 2-Methoxy-4-picoline (2-Methoxy-4-methylpyridine)Synonym : CAS: 100848-70-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Chlorosulfonic acidSynonym : CAS: 7790-94-5Formula: HSO3ClMolecular Weight : 116.52Alternative CAS RN : –EC Number: 232-234-6MDL Number : MFCD00011523Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 4-Nitrobenzyl chloroformateSynonym : Chloroformic acid 4-nitrobenzyl ester; 4-Nitrobenzyl carbonochloridoateCAS: 4457-32-3Formula: C8H6ClNO4Molecular Weight : 215.59Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +4°CShipping Temperature…
Product Name : 17α,20β-Dihydroxy-4-pregnen-3-oneSynonym : 17α,20β-Dihydroxyprogesterone; 17α-Hydroxy-20β-dihydroprogesterone; 4-Pregnene-17α,20β-diol-3-one; Maturation Inducing hormone (MIF)CAS: 1662-06-2Formula: C21H32O3Molecular Weight : 332.48Alternative CAS RN : –EC Number: –MDL Number : MFCD00010485Storage Temperature : –Shipping Temperature…
Product Name : 2-Hydroxy-3-nitro-5-picoline (2-Hydroxy-5-methyl-3-nitropyridine)Synonym : CAS: 7464-14-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 9-(β-D-Galactopyranosyloxy)nonanoic AcidSynonym : CAS: 83345-63-5Formula: Molecular Weight : 336.38Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Bromopyridine-3-carbonitrileSynonym : CAS: 35590-37-5Formula: C6H3BrN2Molecular Weight : 183.01Alternative CAS RN : –EC Number: –MDL Number : MFCD00174363Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3-Bromo-4-methylaniline…
He peroxidasecoated bands. Protein oxidation detection was performed utilizing OxyBlot Kit (Millipore Billerica, Boston, MA, USA) as outlined by manufacturer’s guidelines. NAD Measurement Mice were sacrificed at postnatal days 30…
Product Name : 5-Chloro-2-nitrodiphenylamineSynonym : CAS: 25781-92-4Formula: C12H9ClN2O2Molecular Weight : 248.67Alternative CAS RN : –EC Number: 247-261-9MDL Number : MFCD00007287Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292144004-Acetoxy-2-naphthoic…
Product Name : Fluoroethyl 4-toluenesulfonateSynonym : CAS: 383-50-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,7-DihydroxynaphthaleneSynonym : CAS: 575-38-2Formula: C10H8O2Molecular Weight : 160.17Alternative CAS RN : –EC Number: 209-383-0MDL Number : MFCD00035720Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290729003,4-Dibromofuran-2,5-dione…
Product Name : 1-MethylimidazoleSynonym : CAS: 616-47-7Formula: C4H6N2Molecular Weight : 82.11Alternative CAS RN : –EC Number: 210-484-7MDL Number : MFCD00005292Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293329901620575-06-5…
Product Name : Tetrabutylphosphonium bromideSynonym : CAS: 3115-68-2Formula: 4PBrMolecular Weight : 339.35Alternative CAS RN : –EC Number: 221-487-8MDL Number : MFCD00011853Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Benzyltributylammonium chlorideSynonym : CAS: 23616-79-7Formula: 3N(CH2C6H5)ClMolecular Weight : 311.94Alternative CAS RN : –EC Number: 245-787-3MDL Number : MFCD00011849Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Propyl β-D-lactosideSynonym : CAS: 115075-17-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : DL-AminoglutethimideSynonym : 3-(p-Aminophenyl)-3-ethylpiperidine-2,6-dione; 3-(4-Aminophenyl)-3-ethyl-2,6-piperidinedioneCAS: 125-84-8Formula: C13H16N2O2Molecular Weight : 232.28Alternative CAS RN : –EC Number: 204-756-4MDL Number : MFCD00010122Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,2,2-Trifluoroethylamine hydrochlorideSynonym : CAS: 373-88-6Formula: C2F3H4NHClMolecular Weight : 135.52Alternative CAS RN : –EC Number: 206-771-1MDL Number : MFCD00012875Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-Bromo-4-nitrotolueneSynonym : CAS: 7745-93-9Formula: C7H6BrNO2Molecular Weight : 216.04Alternative CAS RN : –EC Number: 231-809-9MDL Number : MFCD00007195Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29049095612501-45-8…
Product Name : 6-Diazo-5-oxo-L-norleucineSynonym : (S)-2-Amino-6-diazo-5-oxocaproic acid; DONCAS: 157-03-9Formula: C6H9N3O3Molecular Weight : 171.15Alternative CAS RN : –EC Number: –MDL Number : MFCD00037218Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 6α-Methylprednisolone 21-hemisuccinate sodium saltSynonym : 6α-Methyl-11β,17α,21-trihydroxy-1,4-pregnadiene-3,20-dione 21-hemisuccinateCAS: 2375-03-3Formula: C26H33O8NaMolecular Weight : 496.53Alternative CAS RN : –EC Number: 219-156-8MDL Number : MFCD00152612Storage Temperature : –Shipping Temperature : –Harmonised…
Product Name : 4”-Hydroxy-3”-nitroacetophenoneSynonym : CAS: 6322-56-1Formula: C8H7NO4Molecular Weight : 181.15Alternative CAS RN : –EC Number: –MDL Number : MFCD00017002Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –4722-76-3…
Product Name : 2-Amino-5-nitropyridineSynonym : CAS: 4214-76-0Formula: C5H5N3O2Molecular Weight : 139.11Alternative CAS RN : –EC Number: 224-145-6MDL Number : MFCD00006325Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999(4-Aminobutyl)dimethylamine…
Product Name : Ro 41-0960Synonym : 2′-Fluoro-3,4-dihydroxy-5-nitrobenzophenoneCAS: 125628-97-9Formula: C13H8FNO5Molecular Weight : 277.20Alternative CAS RN : –EC Number: –MDL Number : MFCD00078597Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2”,4”-DichloroacetophenoneSynonym : CAS: 2234-16-4Formula: C8H6Cl2OMolecular Weight : 189.04Alternative CAS RN : –EC Number: 218-780-8MDL Number : MFCD00000581Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –28048-17-1…
Product Name : 5-(4-Formyl-3,5-dimethoxyphenoxy)valeric acidSynonym : BAL linker; 4-(4-Formyl-3,5-dimethoxyphenoxy)butyric acidCAS: 197304-21-5Formula: C13H16O6Molecular Weight : 268.26Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…
Product Name : 4-Methoxy-2-nitrobenzoic acidSynonym : CAS: 33844-21-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Unrelated individuals, which means that these sufferers had in all probability acquired PCP from independent sources of infection (as they have been hospitalized at distinct time periods and in distinct…
4-hour supervision. Each subject stayed within the unit for 120 days, which integrated a 14-day baseline observation period, a 3-day pre-overfeeding testing period, a 100-day experimental overfeeding treatment, as well…
Product Name : 4-Methylphenyl 2,3,4-tri-O-benzyl-1-thio-β-D-xylopyranosideSynonym : CAS: 145079-53-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-Chloro-2,4,6-trifluorobenzeneSynonym : CAS: 2106-40-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Benzyl…
Product Name : 2-Amino-5-nitrophenolSynonym : 2-Hydroxy-4-nitroanilineCAS: 121-88-0Formula: C6H6N2O3Molecular Weight : 154.13Alternative CAS RN : –EC Number: 204-503-8MDL Number : MFCD00007692Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29222900Platinum(IV)…
Product Name : 4-Fluoro-3-methylanilineSynonym : CAS: 452-69-7Formula: C7H8FNMolecular Weight : 125.15Alternative CAS RN : –EC Number: 207-207-7MDL Number : MFCD00025294Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Methyl…
Product Name : Propyl 4-hydroxybenzoate, Ph. 1H-Pyrrole-2,3,5-tricarboxylic acid Order Formula of 3-Hydroxy-2-methyl-Butanoic acid Eur. gradeSynonym : 4-Hydroxybenzoic acid propyl ester; Propyl paraben; Propylis parahydroxybenzoas; Propylparaben; p-Hydroxybenzoic acid propylester; 4-Hydroxybenzoic acid…
Product Name : 2-Hydroxypropyl methacrylateSynonym : CAS: 27813-02-1Formula: C7H12O3Molecular Weight : 144.17Alternative CAS RN : –EC Number: 248-666-3MDL Number : MFCD00004536Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Ensus sequence although thinking of all these things.Idrees et al. Theoretical Biology and Healthcare Modelling 2013, ten:24 http://tbiomed/content/10/1/Page 7 ofPhylogenetic analysisHCV E1 and E2 sequences from around the globe have…
L. Calcd for C25H51N2O7P 2O: C, 55.54; H, 9.88; N, 5.18; Found: C, 55.18; H, 9.83; N, 5.14. MS MH+ C25H51N2O7PH+ Calcd: 523.3512, Located: 523.3503. four.3.4. 3--3-oxo-2propyl phosphocholine (23)–To a…
Product Name : 2-Methyl-4-hydroxymethylpyridineSynonym : CAS: 105250-16-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 1,4-Dioxa-8-azaspiro(4.5)decane (4-Piperidone ethylene ketal)Synonym : CAS: 177-11-7Formula: C7H13NO2Molecular Weight : 143.19Alternative CAS RN : –EC Number: 205-868-6MDL Number : MFCD00005976Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : Quinoline-5-boronic acidSynonym : CAS: 355386-94-6Formula: C9H8BNO2Molecular Weight : 172.98Alternative CAS RN : –EC Number: –MDL Number : MFCD03095058Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Ethoxycarbonylphenylboronic acidSynonym : CAS: 4334-88-7Formula: C9H11BO4Molecular Weight : 193.99Alternative CAS RN : –EC Number: –MDL Number : MFCD02179441Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Aluminium acetylacetonateSynonym : CAS: 13963-57-0Formula: C15H21AlO6Molecular Weight : 324.31Alternative CAS RN : –EC Number: 237-741-6MDL Number : MFCD00000013Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Phthalic acidSynonym : 1,2-Benzenedicarboxylic acid; Benzene-1,2-dicarboxylic acidCAS: 88-99-3Formula: C8H6O4Molecular Weight : 166.13Alternative CAS RN : –EC Number: 201-873-2MDL Number : MFCD00002467Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Junct therapy. A few research have investigated the potential of inositol, a member of vitamin B family members in bipolar disorder (Chengappa et al., 2000; Eden Evins et al., 2006).…
Ed to possess high antioxidant properties. The antioxidant activity of phenolic compounds is mainly as a result of their redox properties which enable them to act as radical scavengers, metal…
Product Name : VAHASynonym : Valproyl hydroxamic acid, VPA-HACAS: 106132-78-9Formula: C8H17NO2Molecular Weight : 159.23Alternative CAS RN : –EC Number: –MDL Number : MFCD12756348Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff…
Product Name : 4-Cyanobenzyl bromideSynonym : CAS: 17201-43-3Formula: C8H6BrNMolecular Weight : 196.05Alternative CAS RN : –EC Number: 241-246-0MDL Number : MFCD00001829Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : o-Nitrophenyl b-D-Galactopyranoside-6-phosphate cyclohexylammonium saltSynonym : o-Nitrophenyl β-D-Galactopyranoside-6-phosphate cyclohexylammonium saltCAS: 25405-62-3Formula: C12H16NO11P · C6H13NMolecular Weight : 480.41Alternative CAS RN : 20943-01-5EC Number: –MDL Number : –Storage Temperature :…
Product Name : 1-Aza-15-Crown-5Synonym : CAS: 66943-05-3Formula: C10H21NO4Molecular Weight : 219.28Alternative CAS RN : –EC Number: 266-523-3MDL Number : MFCD00075465Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : –α-(Bromomethyl)-2-pyrazinemethanol…
Product Name : 3-Chloro-4-fluorobenzonitrileSynonym : CAS: 117482-84-5Formula: C7H3ClFNMolecular Weight : 155.56Alternative CAS RN : –EC Number: –MDL Number : MFCD00015431Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –5-Amino-1H-1,2,4-triazole-3-carboxamide…
Product Name : 1,3-Acetonedicarboxylic acidSynonym : CAS: 542-05-2Formula: C5H6O5Molecular Weight : 146.10Alternative CAS RN : –EC Number: 208-797-9MDL Number : MFCD00002711Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
, ALA and MALTo study the interaction of PDT pro-drugs ALA and MAL along with the native substrate GABA in the GAT models, the ligands have been docked in to…
For 1 candidate drug of interest, the angiotensin-II-receptor blocker candesartan. Initial, we assessed whether concomitant candesartan dosing merely altered the major pharmacokinetics of temozolomide . We located candesartan didn’t considerably…
Product Name : YC-1Synonym : 3-(5′-Hydroxymethyl-2′-furyl)-1-benzyl indazoleCAS: 170632-47-0Formula: C19H16N2O2Molecular Weight : 304.34Alternative CAS RN : –EC Number: –MDL Number : MFCD06407798Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : SB 220025 trihydrochlorideSynonym : 5-(2-Aminopyrimidin-4-yl)-4-(4-fluorophenyl)-1-(4-piperidinyl)imidazole trihydrochlorideCAS: 197446-75-6Formula: C18H19FN6 · 3HClMolecular Weight : 447.76Alternative CAS RN : –EC Number: –MDL Number : MFCD08705333Storage Temperature : –Shipping Temperature :…
Product Name : GR 103691Synonym : 4′-Acetyl-N-butyl]--4-carboxamideCAS: 162408-66-4Formula: C30H35N3O3Molecular Weight : 485.62Alternative CAS RN : –EC Number: –MDL Number : MFCD00936840Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : (R)-(-)-3-Acetyl-4-benzyl-2-oxazolidinoneSynonym : CAS: 184363-65-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –144740-56-7…
Product Name : 1-Methylindole-2-carboxylic acidSynonym : CAS: 16136-58-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-AcetylindoleSynonym : CAS: 4264-35-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1785259-87-1…
Nitial fluorescence reading was taken to record the basal Ca2+ level (i.e., the resting intracellular Ca2+ levels with out any therapy). The cells had been then exposed to either 0…
Contribute to HIV transcriptional repression. We took benefit of previously described transgenic Drosophila lines that expressed FLAGSEPTEMBER 6, 2013 ?VOLUME 288 ?NUMBERtagged NELF subunits (34), assuming that important proteins that…
Product Name : 2-Chloro-5-methoxyanilineSynonym : CAS: 2401-24-3Formula: C7H8ClNOMolecular Weight : 157.60Alternative CAS RN : –EC Number: 219-277-6MDL Number : MFCD00047830Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1780038-41-6…
Product Name : 2-Amino-1-butanolSynonym : CAS: 96-20-8Formula: C4H11NOMolecular Weight : 89.14Alternative CAS RN : –EC Number: 202-488-2MDL Number : MFCD00008095Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292219853-Amino-4-pyridinecarboxaldehyde…
Product Name : 2-Chloro-5-nitro-4-picoline (2-Chloro-4-methyl-5-nitropyridine)Synonym : CAS: 23056-33-9Formula: C6H5ClN2O2Molecular Weight : 172.57Alternative CAS RN : –EC Number: –MDL Number : MFCD00010688Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methylphenyl 2,4-di-O-acetyl-1-thio-β-D-glucopyranosylurono-6,3-lactoneSynonym : CAS: Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Pyridinium p-toluenesulfonateSynonym : PPTS; p-Toluenesulfonic acid pyridine salt; Pyridine p-toluenesulfonate; Pyridinium tosylate; Pyridinium-p-toluenesulfonateCAS: 24057-28-1Formula: C12H13NO3SMolecular Weight : 251.31Alternative CAS RN : –EC Number: 246-002-7MDL Number : MFCD00013108Storage…
Product Name : 2,4-ThiazolidinedioneSynonym : CAS: 2295-31-0Formula: C3H3NO2SMolecular Weight : 117.13Alternative CAS RN : –EC Number: 218-941-2MDL Number : MFCD00005478Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293410001402664-68-9…
Ng that Se(IV) can counteract the toxicity induced by Pb(II). Similarly, without the supplementation of 0.01 mM of Se(IV), a substantial lower in head thrash occurred in worms exposed to…
In expression within the complete information set and involving tumours groups as described above. IPO8 had the lowest normal deviation (SD) with the Ct value across the groups (imply Ct…
Product Name : 4-HydroxybenzaldehydeSynonym : CAS: 123-08-0Formula: C7H6O2Molecular Weight : 122.12Alternative CAS RN : –EC Number: 204-599-1MDL Number : MFCD00006939Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 291249001,4-Dihydropyrazine-2,3-dithione…
Product Name : AminopyrazineSynonym : CAS: 5049-61-6Formula: C4H5N3Molecular Weight : 95.11Alternative CAS RN : –EC Number: 225-748-7MDL Number : MFCD00006137Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29339980G0-C14…
Product Name : 5-Amino-2-chloro-3-methylpyridineSynonym : CAS: 38186-82-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Salicylic…
Product Name : Hepta-O-acetyl-b-lactosyl azideSynonym : Hepta-O-acetyl-β-lactosyl azide; Hepta-O-acetyl-beta-lactosyl azide; b-Lactosyl azide heptaacetate; 2,3,6-Tri-O-acetyl-4-O-(2,3,4,6-tetra-O-acetyl-b-D-galactopyranosyl)-b-D-glucopyranosyl azide; β-Lactosyl azide heptaacetate; beta-Lactosyl azide heptaacetateCAS: 30854-62-7Formula: C26H35N3O17Molecular Weight : 661.57Alternative CAS RN : –EC…
Product Name : Furan-3-carboxaldehydeSynonym : CAS: 498-60-2Formula: C5H4O2Molecular Weight : 96.09Alternative CAS RN : –EC Number: –MDL Number : MFCD00010424Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : –4-Nitrobutan-1-ol…
Product Name : N,N-DiethylethylenediamineSynonym : CAS: 100-36-7Formula: (CH3CH2)2NCH2CH2NH2Molecular Weight : 116.21Alternative CAS RN : –EC Number: 202-844-7MDL Number : MFCD00008176Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29212900Buy1228875-16-8…
N a previous study, we assessed the possible of sivelestat, a competitive inhibitor of human neutrophil elastase (NE) (8), within the protection against acute pancreatitis-associated lung injury within a rat…
E burden of DILI vary in accordance with criteria for cohort choice.eight,9 In a population-based study from a rural location in France,10 the crude international incidence of DILI was 13.9…
Product Name : TriphenylbismuthSynonym : CAS: 603-33-8Formula: (C6H5)3BiMolecular Weight : 440.30Alternative CAS RN : –EC Number: 210-033-4MDL Number : MFCD00014064Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293190905-Bromo-4-chloro-2-methylpyrimidine…
Product Name : Cyanidin chlorideSynonym : 3,3′,4,5,7-Pentahydroxyflavylium chlorideCAS: 528-58-5Formula: C15H11ClO6Molecular Weight : 322.70Alternative CAS RN : –EC Number: 208-438-6MDL Number : MFCD00017582Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : Potassium phthalimideSynonym : CAS: 1074-82-4Formula: C8H4KNO2Molecular Weight : 185.23Alternative CAS RN : –EC Number: 214-046-6MDL Number : MFCD00005887Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Amino-5-chloro-4-picoline (2-Amino-5-chloro-4-methylpyridine)Synonym : CAS: 36936-27-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-BenzoylbiphenylSynonym : CAS: 2128-93-0Formula: C19H14OMolecular Weight : 258.32Alternative CAS RN : –EC Number: 218-345-2MDL Number : MFCD00003079Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 291439003-Bromo-1,8-naphthyridine…
Product Name : 4-Picoline-N-oxideSynonym : CAS: 1003-67-4Formula: C6H7NOMolecular Weight : 109.13Alternative CAS RN : –EC Number: 213-712-3MDL Number : MFCD00006210Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999BuyNon-8-yn-1-ol…
Nstrated equivalent prevention of breast cancer at a risk reduction of roughly 50 . Raloxifene had fewer adverse events, particularly endometrial carcinoma/dysplasia and thromboembolic illness.11 Evaluation from the information later,…
Ical function of Bcl-2 is to regulate mitochondrial respiration , which may perhaps account for its capability to alter the redox atmosphere. Chen et al. showed that Bcl-2 regulates the…
Product Name : 4-Octyloxybenzoic acidSynonym : CAS: 2493-84-7Formula: C15H22O3Molecular Weight : 250.34Alternative CAS RN : –EC Number: –MDL Number : MFCD00013993Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-CarboxybenzaldehydeSynonym : CAS: 119-67-5Formula: C8H6O3Molecular Weight : 150.13Alternative CAS RN : –EC Number: 204-342-3MDL Number : MFCD00003336Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29183000Sucrose…
Product Name : Succinic anhydrideSynonym : Dihydro-2,5-furandione; Butanedioic anhydrideCAS: 108-30-5Formula: C4H4O3Molecular Weight : 100.07Alternative CAS RN : –EC Number: 203-570-0MDL Number : MFCD00005525Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : CMP-N-acetylneuraminic acid sodium saltSynonym : CAS: 37399-47-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : 2-Iodophenylacetic acidSynonym : CAS: 18698-96-9Formula: C8H7IO2Molecular Weight : 262.05Alternative CAS RN : –EC Number: –MDL Number : MFCD00046546Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Hydroxy-3-methylglutaric acidSynonym : 3-Hydroxy-3-methylpentanedioic acid; Meglutol; Dicrotalic acid; β-hydroxy-β-methylglutaric acidCAS: 503-49-1Formula: C6H10O5Molecular Weight : 162.14Alternative CAS RN : –EC Number: 207-971-1MDL Number : –Storage Temperature : -20°CShipping…
Of yeast mutants by T. cruzi genes.Yeast mutants YPH499 DPM1 YPH499 GPI3 YPH499 GPI12 YPH499 GPI14 YPH499 GPI10 YPH499 GAA1 YPH499 GPI8 YPH499 AURpRS Tc + two + two +…
N unchallenged LIGHT-deficient mice because the result in for the observed exacerbated illness phenotype. On the other hand, it is not surprising that LIGHTdeficient mice displayed regular intestinal barrier function…
Product Name : (+/-)-beta-Hydroxy-gamma-butyrolactoneSynonym : CAS: 5469-16-9Formula: C4H6O3Molecular Weight : 102.09Alternative CAS RN : –EC Number: –MDL Number : MFCD00090014Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 1,3,5-TrimethoxybenzeneSynonym : CAS: 621-23-8Formula: C9H12O3Molecular Weight : 168.19Alternative CAS RN : –EC Number: 210-673-4MDL Number : MFCD00008385Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29093090Formula…
Product Name : 7-Hydroxy-3-methyl-4-phenylcoumarinSynonym : CAS: 54431-13-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –71989-18-9…
Product Name : Cathine hydrochlorideSynonym : threo-2-Amino-1-hydroxy-1-phenyl propane hydrochloride; Pseudonorephedrine hydrochloride; S,S-Norpseudoephedrine hydrochlorideCAS: 2153-98-2Formula: C9H13NO · HClMolecular Weight : 187.67Alternative CAS RN : –EC Number: 218-446-1MDL Number : MFCD00070245Storage Temperature…
Product Name : 3-Fluoro-2-methylanilineSynonym : CAS: 443-86-7Formula: C7H8FNMolecular Weight : 125.15Alternative CAS RN : –EC Number: 207-142-4MDL Number : MFCD00007760Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29214300BuyEthyl…
Product Name : Rink Amide Linker (4-((2,4-Dimethoxyphenyl)(FMOC amino)methyl)phenoxyacetic acidSynonym : CAS: 126828-35-1Formula: C32H29NO7Molecular Weight : 539.58Alternative CAS RN : 145069-56-3EC Number: –MDL Number : MFCD00153509Storage Temperature : –Shipping Temperature :…
Ntaining the ENaC promoter or maybe a mutated type,cloned upstream of the firefly luciferase cDNA. E-box 1 (TCCAGCTGTC) at -1116, relative for the transcription commence web-site was mutated to mE-box…
Ocampus and nucleus accumbens? There may be various explanations: for 1, in these experiments, the effects of HDAC3 depletion had been studied right after a comparatively brief period of 2…
Product Name : 1-Pyrenyl b-D-glucuronideSynonym : CAS: 154717-05-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-BromothiopheneSynonym : CAS: 872-31-1Formula: C4H3BrSMolecular Weight : 163.04Alternative CAS RN : –EC Number: 212-821-3MDL Number : MFCD00005464Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29349990Price…
Product Name : (1S,2S,3R,5S)-(+)-2,3-PinanediolSynonym : CAS: 18680-27-8Formula: C10H18O2Molecular Weight : 170.25Alternative CAS RN : –EC Number: –MDL Number : MFCD00077851Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 290619009053902-76-4…
Product Name : trans-Aconitic acidSynonym : trans-Propene-1,2,3-tricarboxylic acidCAS: 4023-65-8Formula: C6H6O6Molecular Weight : 174.11Alternative CAS RN : –EC Number: 223-688-6MDL Number : MFCD00002721Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 2-Fluoro-6-methoxybenzonitrileSynonym : CAS: 94088-46-7Formula: C8H6FNOMolecular Weight : 151.14Alternative CAS RN : –EC Number: 302-047-5MDL Number : MFCD00042291Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : Tetrachloro-p-benzoquinoneSynonym : 2,3,5,6-Tetrachloro-1,4-benzoquinone; p-Chloranil; ChloranilCAS: 118-75-2Formula: C6Cl4O2Molecular Weight : 245.88Alternative CAS RN : –EC Number: 204-274-4MDL Number : MFCD00001594Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Ime points following VEGFA stimulation. Note locations with varying H3K27ac occupancy in response to VEGFA (boxed regions). Bracketed regions are enlarged in portions of panel C. (C ) H3K27ac variance…
Or perhaps a total volume of ml, as described above. The reactions were incubated at 30uC for 45 min. The reactions were stopped on ice, and diluted to 250 ml…
Product Name : 1-Octacosanol, 85%Synonym : CAS: 557-61-9Formula: C28H58OMolecular Weight : 410.76Alternative CAS RN : –EC Number: 209-181-2MDL Number : MFCD00044770Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Sodium hydrogen seleniteSynonym : Sodium biselenite; Sodium hydroseleniteCAS: 7782-82-3Formula: HNaO3SeMolecular Weight : 150.96Alternative CAS RN : –EC Number: 231-966-3MDL Number : MFCD00003525Storage Temperature : +20°CShipping Temperature :…
Product Name : 5-Chloro-1-phenyltetrazoleSynonym : 5-Chloro-1-phenyl-1H-tetrazoleCAS: 14210-25-4Formula: C7H5ClN4Molecular Weight : 180.60Alternative CAS RN : –EC Number: 238-065-4MDL Number : MFCD00003128Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29339980Buy6-Chloro-5-methylpyridazin-3(2H)-one…
Product Name : Ammonium tetrachloroplatinate(II); 99.9%Synonym : Platinum(II)-ammonium chlorideCAS: 13820-41-2Formula: H8Cl4N2PtMolecular Weight : 372.98Alternative CAS RN : –EC Number: 237-499-1MDL Number : MFCD00010885Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 4-Chloronicotinic acidSynonym : CAS: 10177-29-4Formula: C6H4ClNO2Molecular Weight : 157.56Alternative CAS RN : –EC Number: –MDL Number : MFCD00128860Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Pyridine-2-methanol (2-Pyridylcarbinol)Synonym : CAS: 586-98-1Formula: C6H7NOMolecular Weight : 109.13Alternative CAS RN : –EC Number: 209-592-7MDL Number : MFCD00006348Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
L. 22, No.the activity in the FRMD7 NES, potentially by way of phosphorylation, could influence its nuclear localization for the duration of brain development. In this regard, it is actually…
Ile in 0.five acetic acid answer and analyzed on an EASY-nLC system (Thermo Scientific) connected to a Q-Exactive (Thermo Scientific) mass spectrometer. A 15-cm column of 75- m diameter packed…
Product Name : 2-Chloro-p-xyleneSynonym : CAS: 95-72-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29039990Formula…
Product Name : Fluoxetine hydrochlorideSynonym : CAS: 56296-78-7Formula: Molecular Weight : Alternative CAS RN : 59333-67-4EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3,4-DichloroanilineSynonym : CAS: 95-76-1Formula: C6H5Cl2NMolecular Weight : 162.02Alternative CAS RN : –EC Number: 202-448-4MDL Number : MFCD00007768Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29214200Price…
Product Name : 2,5-Dichloroisonicotinic acidSynonym : CAS: 88912-26-9Formula: C6H3Cl2NO2Molecular Weight : 192.00Alternative CAS RN : –EC Number: –MDL Number : MFCD00466640Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Neostigmine bromideSynonym : 3-(N,N-Dimethylcarbamoyloxy)-N,N,N,-trimethylanilinium bromide; ProstigmineCAS: 114-80-7Formula: C12H19BrN2O2Molecular Weight : 303.20Alternative CAS RN : –EC Number: 204-054-8MDL Number : MFCD00011795Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 4-Nitrophenyl hepta-O-acetyl-b-lactosideSynonym : CAS: 84034-75-3Formula: C32H39NO20Molecular Weight : 757.65Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
S downstream of Dam1. Our information assistance the model that biorientation, as soon as accomplished, enables PP1 to dephosphorylate Dam1, which extinguishes the SAC signal individually on every sister kinetochore.…
6.294), and TP53 probably the most drastically inactivated (z-score of -7.660) transcription aspect. Other very predicted activated transcription aspects had been e.g. E2F1/2/3 (Further file six). These diverse transcription things…
Product Name : p-Tolylboronic acidSynonym : (p-Methylphenyl)boronic acid; 4-Methylphenylboronic acid; 4-Tolueneboronic acid; 4-Tolylboronic acid; p-Tolueneboronic acid; NSC 62870; p-Methylbenzeneboronic acid; 4-Methylbenzeneboronic acidCAS: 5720-05-8Formula: C7H9BO2Molecular Weight : 135.96Alternative CAS RN :…
Product Name : 3-AcetylcoumarinSynonym : CAS: 3949-36-8Formula: C11H8O3Molecular Weight : 188.18Alternative CAS RN : –EC Number: 223-541-6MDL Number : MFCD00006853Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29322090194924-95-3…
Product Name : cis-11,14-Eicosadienoic acidSynonym : CAS: 2091-39-6Formula: CH3(CH2)4(CH=CHCH2)2(CH2)8CO2HMolecular Weight : 308.50Alternative CAS RN : –EC Number: –MDL Number : MFCD00673431Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : CycloheptanoneSynonym : CAS: 502-42-1Formula: C7H12OMolecular Weight : 112.17Alternative CAS RN : –EC Number: 207-937-6MDL Number : MFCD00004159Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 291429004,6-Dibromopicolinic…
Product Name : Heptanoic acidSynonym : Enanthic acid; Oenanthic acidCAS: 111-14-8Formula: C7H14O2Molecular Weight : 130.19Alternative CAS RN : –EC Number: 203-838-7MDL Number : MFCD00004426Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 2-Nitrobenzyl bromideSynonym : CAS: 3958-60-9Formula: C7H6BrNO2Molecular Weight : 216.04Alternative CAS RN : –EC Number: 223-558-9MDL Number : MFCD00007184Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
7. 30. Meng, F., A. Abedini, ., D. P. Raleigh. 2010. The flavanol (?-epigallocatechin 3-gallate inhibits amyloid formation by islet amyloid polypeptide, disaggregates amyloid fibrils, and protects cultured cells against…
Erexpression of regucalcin has been located to possess a suppressive impact on apoptotic cell death induced by TNF-a, TGF-b, LPS, Bay K 8644, or thapsigargin in NRK52E cells. The impact…
Product Name : Tyrphostin AG 835Synonym : (+)-(S)-N-(α-Methylbenzyl)-3,4-dihydroxybenzylidenecyanoacetamide; Tyrphostin B50CAS: 133550-37-5Formula: C18H16N2O3Molecular Weight : 308.33Alternative CAS RN : –EC Number: –MDL Number : MFCD00209855Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : 5--1--2,3-dihydro-1H-indole-7-carbonitrile (2R,3R)-2,3-dihydroxybutanedioateSynonym : CAS: 239463-85-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-BromophenylacetonitrileSynonym : CAS: 19472-74-3Formula: C8H6BrNMolecular Weight : 196.05Alternative CAS RN : –EC Number: 243-091-4MDL Number : MFCD00001896Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292690951415559-47-5…
Product Name : Decanoic anhydrideSynonym : Capric anhydrideCAS: 2082-76-0Formula: 2OMolecular Weight : 326.51Alternative CAS RN : –EC Number: 218-213-4MDL Number : MFCD00010460Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 3-(4-Chlorophenyl)-1,1-dimethylureaSynonym : MonuronCAS: 150-68-5Formula: C9H11ClN2OMolecular Weight : 198.65Alternative CAS RN : –EC Number: 205-766-1MDL Number : MFCD00018556Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29242100BuyFmoc-OSu…
Product Name : Benzyl 2,3-di-O-benzyl-4-O-methyl-β-D-glucopyranosiduronic acid benzyl esterSynonym : CAS: Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised…
Was no substantial distinction in overall expression levels between the mutant and parental GPs (Fig. three). Identification of the epitopes of mAbs AGP127-8 and MGP72-17 The mutations discovered inside the…
Prep RNA Amplification Kit (Ambion, Inc.) in accordance with the manufacturer’s instructions. The labeled probes had been hybridized overnight at 58 to theAnticancer Agents Med Chem. Author manuscript; obtainable in…
Product Name : 4,6-DihydroxypyrimidineSynonym : CAS: 1193-24-4Formula: C4H4N2O2Molecular Weight : 112.09Alternative CAS RN : –EC Number: 214-772-3MDL Number : MFCD00016733Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29335995900Formula…
Product Name : 2-Bromo-3-fluoropyridineSynonym : CAS: 40273-45-8Formula: C5H3BrFNMolecular Weight : 175.99Alternative CAS RN : –EC Number: –MDL Number : MFCD04114128Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : Ethyl-4-pyrazolecarboxylateSynonym : CAS: 37622-90-5Formula: C6H8N2O2Molecular Weight : 140.14Alternative CAS RN : –EC Number: –MDL Number : MFCD00010844Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –3-Fluoro-4-iodo-2-methoxypyridine…
Product Name : Ethyl 4-bromocrotonateSynonym : Ethyl 4-bromobut-2-enoate; Ethyl trans-4-bromo-2-butenoateCAS: 37746-78-4Formula: C6H9BrO2Molecular Weight : 193.05Alternative CAS RN : –EC Number: –MDL Number : MFCD00000247Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 5,6,7,8-TetrahydroquinolineSynonym : CAS: 10500-57-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293349901892-57-5…
Product Name : N-EthylbenzylamineSynonym : CAS: 14321-27-8Formula: C6H5CH2NHCH2CH3Molecular Weight : 135.21Alternative CAS RN : –EC Number: 238-265-1MDL Number : MFCD00009031Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292149004-Bromo-5-fluoropyridin-2-amine…
(Scheme 3) . We tested methyl vinyl ketone (8) as a cross-metathesis partner, along with the recently described Umicore M51 initiator (A) , as well asBeilstein J. Org. Chem. 2013,…
Single-channel pictures. Colocalization of polymer/PMO to the lysosome was visualized by merged channel pictures.POLYMER-BASED ANTISENSE DELIVERYFIG. 1. Synthesis of poly(ester amine)s based on TAEI cross-linked LPEI. LPEI, low-molecular-weight polyethylenimine; TAEI,…
Product Name : EthoxymethylenemalononitrileSynonym : CAS: 123-06-8Formula: C6H6N2OMolecular Weight : 122.13Alternative CAS RN : –EC Number: 204-597-0MDL Number : MFCD00001854Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29269095Bis(2-(2-methoxyethoxy)ethyl)amine…
Product Name : Ethyl (R)-(+)-4-chloro-3-hydroxybutyrateSynonym : CAS: 90866-33-4Formula: C6H11ClO3Molecular Weight : 166.61Alternative CAS RN : –EC Number: –MDL Number : MFCD00211242Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-BromotolueneSynonym : CAS: 591-17-3Formula: C7H7BrMolecular Weight : 171.04Alternative CAS RN : –EC Number: 209-702-3MDL Number : MFCD00000085Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29039990Methyl…
Product Name : 4-Nitrophthalic anhydrideSynonym : CAS: 5466-84-2Formula: C8H3NO5Molecular Weight : 193.11Alternative CAS RN : –EC Number: 226-776-2MDL Number : MFCD00005922Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 1,2,3,5-Tetra-O-acetyl-b-L-ribofuranoseSynonym : β-L-Ribofuranose 1,2,3,5-tetra-O-acetateCAS: 144490-03-9Formula: C13H18O9Molecular Weight : 318.30Alternative CAS RN : –EC Number: –MDL Number : MFCD00674547Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 4-Methoxybenzyl chlorideSynonym : CAS: 824-94-2Formula: C8H9ClOMolecular Weight : 156.61Alternative CAS RN : –EC Number: 212-540-6MDL Number : MFCD00000915Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Olumn (250?.six mm), the column temperature was 25 , the elution solvent was acetonitrile sopropanol? phosphoric acid remedy (80:five:15), the flow price was 0.five ml/min, plus the detection wavelength was…
Rogens with the dehydro-b-homoverdins relative to the b-homoverdins. Added help for the assigned structures comes from exact-mass determinations of their molecular weights, e.g., for 3e and 5e. Rapid atom bombardment…
Product Name : 1-IndanolSynonym : 1-Hydroxyhydrindene; 1-Hydroxyindan; (±)-1-Indanol; (±)-1-HydroxyindanCAS: 6351-10-6Formula: C9H10OMolecular Weight : 134.18Alternative CAS RN : –EC Number: 224-230-8MDL Number : MFCD00003797Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 2,5-Dimethoxybenzoic acidSynonym : CAS: 2785-98-0Formula: C9H10O4Molecular Weight : 182.18Alternative CAS RN : –EC Number: 220-503-0MDL Number : MFCD00002436Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-(3-Acetamidophenyl)tetrazole-5-thiolSynonym : CAS: 14070-48-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 2933998013-Bromotridec-1-ene…
Product Name : Octyl 2,3,4,6-O-Tetraacetyl-β-D-mannopyranosideSynonym : CAS: 128299-96-7Formula: Molecular Weight : 460.52Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 3”,4”-DifluoroacetophenoneSynonym : CAS: 369-33-5Formula: C8H6F2OMolecular Weight : 156.13Alternative CAS RN : –EC Number: 206-717-7MDL Number : MFCD00009891Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29147000Formula…
Product Name : 4-HydroxyphenylacetonitrileSynonym : CAS: 14191-95-8Formula: C8H7NOMolecular Weight : 133.15Alternative CAS RN : –EC Number: 238-046-0MDL Number : MFCD00002383Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292690951784125-40-1…
Tion for 30 min at 48 and final inactivation for 5-min at 95 . True time PCR was carried out within a Chromosome 4 cycler (Bio-Rad, USA) applying MESA GREEN…
Emia. Hypercholesterolemia was induced experimentally in 12 h-fasted rats by a single intraperitoneal injection of Triton WR-1339 (300 mg/kg physique weight (b.wt.)) dissolved in 0.89 saline . Forty-eight hours just…
Product Name : 4”-Chloro-2,2-difluorobenzodioxoleSynonym : CAS: 72769-08-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2,4-Dibromo-3-methylpyridine…
Product Name : 2-Fluorophenacyl bromideSynonym : CAS: 655-15-2Formula: C8H6BrFOMolecular Weight : 217.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00278796Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Fusidic acid sodium saltSynonym : Fucidin; Sodium (Z)-ent-16α-(acetyloxy)-3β,11β-dihydroxy-4β,8,14- trimethyl-18-nor-5β,10α-cholesta-17(20);24-dien-21-oate; Sodium fusidateCAS: 751-94-0Formula: C31H47O6NaMolecular Weight : 538.7Alternative CAS RN : –EC Number: 212-030-3MDL Number : MFCD09054714Storage Temperature :…
Product Name : 6-Methylpyridine-2-methanolSynonym : CAS: 1122-71-0Formula: C7H9NOMolecular Weight : 123.15Alternative CAS RN : –EC Number: 214-358-2MDL Number : MFCD00023520Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293339992135443-03-5…
Product Name : Ethylene glycol dimethyl ether (1,2-Dimethoxyethane)Synonym : CAS: 110-71-4Formula: C4H10O2Molecular Weight : 90.12Alternative CAS RN : –EC Number: 203-794-9MDL Number : MFCD00008502Storage Temperature : –Shipping Temperature : –Harmonised…
Product Name : 4-Penten-1-olSynonym : 2-Allylethyl alcoholCAS: 821-09-0Formula: H2C=CH(CH2)3OHMolecular Weight : 86.13Alternative CAS RN : –EC Number: 212-473-2MDL Number : MFCD00002975Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff Code…
P:// creativecommons.org/licenses/by-nc/3.0/13. 14. Goetz CG, Leurgans S, Pappert EJ, et al. Potential longitudinal assessment of hallucinations in Parkinson’s illness. Neurology 2001;57:2078?2. Williams DR, Lees AJ. Visual hallucinations within the diagnosis…
Iwan might continue to lower, but this can be uncertain. The threat of a traveler acquiring malaria is considered the highest in sub-Saharan Africa and Papua New Guinea, intermediate on…
Product Name : Methyl o-toluateSynonym : CAS: 89-71-4Formula: C9H10O2Molecular Weight : 150.18Alternative CAS RN : –EC Number: 201-932-2MDL Number : MFCD00008428Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Bromo-5-fluoropyridineSynonym : CAS: 407-20-5Formula: C5H3BrFNMolecular Weight : 175.99Alternative CAS RN : –EC Number: –MDL Number : MFCD04112555Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyOseltamivir…
Product Name : CHM-1 hydrateSynonym : 2-(2-fluorophenyl)-6,7-methylenedioxy-2-4-quinolone hydrate; NSC 656158CAS: 154554-41-3Formula: C16H10FNO3 · xH2OMolecular Weight : 283.25 (anhydrous)Alternative CAS RN : –EC Number: –MDL Number : MFCD11114577Storage Temperature : +4°CShipping…
Product Name : 3′-AminoacetophenoneSynonym : CAS: 99-03-6Formula: C8H9NOMolecular Weight : 135.17Alternative CAS RN : –EC Number: 202-722-3MDL Number : MFCD00007796Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 292239003-(4-Fluorophenoxy)azetidine…
Product Name : Methyl 2,3,4-tri-O-benzoyl-6-O-trityl-a-D-glucopyranosideSynonym : CAS: 20231-39-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : (2-Iodoethyl)benzeneSynonym : CAS: 17376-04-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Amped in syx3-69 and cpxSH1 null Drosophila mutants. (A) Focal recordings of spontaneous activity from visualized boutons. Left: FM1-43 staining; middle: overlay using the bright-field image; right: overlay with the…
For HCC in GSD-III. Improvement of suggestions to allow for systematic review and microarray research are required to better delineate the etiology on the HCC in sufferers with GSD-III. You’ll…
Product Name : Phenamil methanesulfonate saltSynonym : 3,5-Diamino-6-chloro-N-pyrazinecarboxamide methanesulfonate saltCAS: 1161-94-0Formula: C12H12ClN7O · CH3SO3HMolecular Weight : 401.83Alternative CAS RN : –EC Number: –MDL Number : MFCD00274070Storage Temperature : +4°CShipping Temperature…
Product Name : 1-Octyn-3-olSynonym : CAS: 818-72-4Formula: C8H14OMolecular Weight : 126.20Alternative CAS RN : –EC Number: 212-455-4MDL Number : MFCD00004588Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29052990BuyLaduviglusib…
Product Name : Iron(II) sulfate heptahydate, 99.5%Synonym : Ferrous sulfate heptahydrate; Ferrous sulphate heptahydrate; Iron(II) sulphate heptahydate; Iron sulphateCAS: 7782-63-0Formula: FeO4S · 7H2OMolecular Weight : 278.02Alternative CAS RN : 7720-78-7,…
Product Name : tert-Butyl bromoacetateSynonym : CAS: 5292-43-3Formula: C6H11BrO2Molecular Weight : 195.06Alternative CAS RN : –EC Number: 226-133-6MDL Number : MFCD00000188Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Trichloroacetic acidSynonym : TCA; 2,2,2-Trichloroacetic acidCAS: 76-03-9Formula: Cl3CCO2HMolecular Weight : 163.39Alternative CAS RN : –EC Number: 200-927-2MDL Number : MFCD00004177Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : di-Potassium hydrogen phosphate, anhydrous, Ph. (R)-(Tetrahydrofuran-2-yl)methanol uses 1310680-18-2 web Eur. gradeSynonym : Dipotassium hydrogenphosphate; Dipotassium phosphate; sec.-Potassium phosphate; Potassium phosphate dibasic; Potassium phosphate, dibasicCAS: 7758-11-4Formula: K2HPO4Molecular Weight…
14-3-3 protein at the P. brasiliensis cell surface raises exciting queries: as an example, how is this protein incorporated in to the cell wall inside the absence of a standard…
Ction with 0.4 mM IPTG at 37uC. (B) 1: LMW, 2: purified protein. The arrow indicates the purified 14-3-3 recombinant protein. (C) Immunoblot to confirm the reactivity of polyclonal serum…
Product Name : D-Glucose-6-phosphate monosodium saltSynonym : D(+)-Glucopyranose 6-phosphate sodium salt; G-6-P Na; Robison esterCAS: 54010-71-8Formula: C6H12NaO9PMolecular Weight : 282.12Alternative CAS RN : –EC Number: 258-921-0MDL Number : MFCD00006611Storage Temperature…
Product Name : 2-Cyano-3,5-dichloropyridineSynonym : CAS: 85331-33-5Formula: C6H2Cl2N2Molecular Weight : 173.00Alternative CAS RN : –EC Number: –MDL Number : MFCD03788758Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –36902-22-4…
Product Name : (R)-BaclofenSynonym : CAS: 69308-37-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29224985Buytert-Butyl…
Product Name : o-PhthaldialdehydeSynonym : o-Phthalaldehyde; o-Phthalic dicarboxaldehyde; Benzene-1,2-dicarboxaldehyde; OPACAS: 643-79-8Formula: C8H6O2Molecular Weight : 134.14Alternative CAS RN : –EC Number: 211-402-2MDL Number : MFCD00003335Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…
Product Name : 3-Aminobenzyl alcoholSynonym : CAS: 1877-77-6Formula: C7H9NOMolecular Weight : 123.16Alternative CAS RN : –EC Number: 217-514-8MDL Number : MFCD00007817Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 7-HydroxyindoleSynonym : CAS: 2380-84-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyHoveyda-Grubbs…
Ires administration of significantly less drug, and therefore offers at the very least the prospective to bring about fewer undesired unwanted effects (e.g., panic, agitation, hypertension, or fever as may…
27- epithelial marker expression beyond morphologic look, we examined in vitro cell migration, a defining function on the mesenchymal phenotype, by producing a scratch or wound inside a confluent monolayer…
Product Name : 2,5-DimethylpyrroleSynonym : CAS: 625-84-3Formula: C6H9NMolecular Weight : 95.15Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : –5-Ethynyluridine…
Product Name : 4-Hydrazinobenzoic acidSynonym : CAS: 619-67-0Formula: C7H8N2O2Molecular Weight : 152.15Alternative CAS RN : –EC Number: 210-609-5MDL Number : MFCD00007581Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5,6-Diamino-2,4-dihydroxypyrimidine sulfateSynonym : CAS: 32014-70-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,6-PyridinedimethanolSynonym : CAS: 1195-59-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293339994-Bromo-1H-pyrrolopyridin-6-amine…
Product Name : DL-Mevalonic acid lactoneSynonym : (±)-β-Hydroxy-β-methyl-δ-valerolactone; (±)-3-Hydroxy-3-methyl δ-valerolactone; DL-Mevalolactone; DL-Mevalonic acid lactoneCAS: 674-26-0Formula: C6H10O3Molecular Weight : 130.14Alternative CAS RN : –EC Number: 211-615-0MDL Number : MFCD00006648Storage Temperature :…
Product Name : 6-MethylquinoxalineSynonym : CAS: 6344-72-5Formula: C9H8N2Molecular Weight : 144.18Alternative CAS RN : –EC Number: –MDL Number : MFCD00041001Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy(2-Methyl-2H-indazol-5-yl)boronic…
Er of them created staining in either the hippocampus or DRG of CB1 receptor KO mice. These findings indicated that each antibodies identified the exact same antigen, the CB1 receptor.…
Ung variety two (MODY 2). Am J Physiol Endocrinol Metab 2010, 298:E512 523.15. Zhang YL, Tan XH, Xiao MF, Li H, Mao YQ, Tan HR: Establishment of liver precise glucokinase…
Product Name : 4-Hydroxy-1-methylpiperidineSynonym : CAS: 106-52-5Formula: C6H13NOMolecular Weight : 115.18Alternative CAS RN : –EC Number: 203-406-8MDL Number : MFCD00006500Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999106-86-5…
Product Name : 5-Chloro-8-hydroxyquinolineSynonym : CAS: 130-16-5Formula: C9H6ClNOMolecular Weight : 179.61Alternative CAS RN : –EC Number: 204-978-1MDL Number : MFCD00006788Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29334990947725-04-4…
Product Name : 5-Bromo-8-nitroisoquinolineSynonym : CAS: 63927-23-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –247592-95-6…
Product Name : N-Acetyl-2-O-methyl-α-neuraminic acid methyl ester 4,7,8,9-tetraacetateSynonym : CAS: 73208-80-7Formula: Molecular Weight : 505.47Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : 3,8-Diamino-6-phenylphenanthridineSynonym : CAS: 52009-64-0Formula: C19H15N3Molecular Weight : 285.35Alternative CAS RN : –EC Number: 257-602-3MDL Number : MFCD00075152Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code : –1429218-41-6…
Product Name : 2-Amino-6-methylmercaptopurineSynonym : 2-Amino-6-methylthiopurineCAS: 1198-47-6Formula: C6H7N5SMolecular Weight : 181.22Alternative CAS RN : –EC Number: 214-833-4MDL Number : MFCD00044701Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1823379-92-5…
Monocyte interactions and oxidative stress in human endothelial cells exposed to wood smoke and diesel exhaust particulate matter,” Toxicology Letters, vol. 209, no. two, pp. 121?28, 2012. H. Frikke-Schmidt, M.…
. Bimolecular fluorescence complementationIntroduction Parkinson’s illness (PD) is definitely the second most typical neurodegenerative disorder soon after Alzheimer’s illness. Even so, the mechanisms underlying causation and progression of this disorder…
Product Name : 3-Amino-2-fluoro-6-picoline (3-Amino-2-fluoro-6-methylpyridine)Synonym : CAS: 374633-34-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : OxamflatinSynonym : (2E)-5--pent-2-en-4-ynohydroxamic acidCAS: 151720-43-3Formula: C17H14N2O4SMolecular Weight : 342.37Alternative CAS RN : –EC Number: –MDL Number : MFCD00949087Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Benzyltrimethylammonium tribromideSynonym : CAS: 111865-47-5Formula: C6H5CH2N(CH3)3Br3Molecular Weight : 389.97Alternative CAS RN : –EC Number: –MDL Number : MFCD00134423Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Indole-5-carboxaldehyde (5-Formylindole)Synonym : CAS: 1196-69-6Formula: C9H7NOMolecular Weight : 145.16Alternative CAS RN : –EC Number: –MDL Number : MFCD02093664Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Procyanidin B1Synonym : cis,trans′′-4,8′′-Bi-(3,3′,4′,5,7-Pentahydroxyflavane)CAS: 20315-25-7Formula: C30H26O12Molecular Weight : 578.52Alternative CAS RN : –EC Number: –MDL Number : MFCD01861512Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 3-Chlorocarbonylphenylboronic anhydrideSynonym : CAS: 332154-58-2Formula: C7H4BClO2Molecular Weight : 166.37Alternative CAS RN : –EC Number: –MDL Number : MFCD06801675Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
*P 0.001 versus handle; P 0.05 versus LPS; P 0.01 versus LPS; P 0.001 versus LPS. Information are indicates ?SE of n = eight replicates per group. C, control; CCL6,…
. Prior studies show that the BM stroma protects CML-BC (cell lines9 and major cells10) from TKI-induced cell death. To decide no matter whether PP242 and ABT-263 therapy overcomes microeviromentally-induced…
Product Name : 4-FluorothiophenolSynonym : CAS: 371-42-6Formula: C6H5FSMolecular Weight : 128.17Alternative CAS RN : –EC Number: 206-737-6MDL Number : MFCD00004846Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293090991-Bromo-5-chloro-4-fluoro-2-iodobenzene…
Product Name : Sodium orthovanadateSynonym : Sodium vanadate (ortho); Sodium vanadium oxideCAS: 13721-39-6Formula: Na3O4VMolecular Weight : 183.94Alternative CAS RN : –EC Number: 237-287-9MDL Number : MFCD00003511Storage Temperature : +20°CShipping Temperature…
Product Name : 5-O-Acetyl-4”-O-tert-butyldimethylsilyl-genisteinSynonym : CAS: 1330249-25-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyBenzoisoxazole-5-sulfonyl…
Product Name : 1-Octanesulfonic acid sodium salt monohydrateSynonym : Sodium 1-octanesulfonate monohydrateCAS: 207596-29-0Formula: CH3(CH2)7SO3Na · H2OMolecular Weight : 234.29Alternative CAS RN : 5324-84-5EC Number: 226-195-4MDL Number : MFCD00149551Storage Temperature :…
Product Name : 2-Formylfuran-5-boronic acidSynonym : CAS: 27329-70-0Formula: C5H5BO4Molecular Weight : 139.90Alternative CAS RN : –EC Number: –MDL Number : MFCD01114696Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-Methylindole-3-carboxaldehydeSynonym : CAS: 19012-03-4Formula: C10H9NOMolecular Weight : 159.19Alternative CAS RN : –EC Number: 242-750-3MDL Number : MFCD00014570Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Iodoadenosine…
Ysis of pCTLA4-IgG4 modified imDCs was performed by flow cytometric analysis (FACSCalibur flow cytometer) using the following antibodies: monoclonal antibody (FITC-human CD152-Ig, 501-040) against CD80/CD86 (Ancell Corporation).Mixed Lymphocyte Reaction (MLR)Mouse…
Tance that increases horizontal gene transfer among susceptible and resistant strains.8 It is actually a complex aggregate of bacteria encased in alginate polysaccharides and encoded by the algD gene.7 Biofilm…
Product Name : 4-MethoxyphenethylamineSynonym : CAS: 55-81-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29222900Formula…
Product Name : 2-Chloro-4-methylpyridine (2-Chloro-4-picoline)Synonym : CAS: 3678-62-4Formula: C6H6ClNMolecular Weight : 127.57Alternative CAS RN : –EC Number: 222-951-2MDL Number : MFCD00023418Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : CJ-13610Synonym : Tetrahydro-4-thio]phenyl]-2H-pyran-4-carboxamideCAS: 179420-17-8Formula: C22H23N3O2SMolecular Weight : 393.50Alternative CAS RN : –EC Number: –MDL Number : MFCD00948114Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –Dibutyl…
Product Name : Methyl γ-linolenateSynonym : γ-Linolenic acid methyl ester; ω-6 Linolenic acid methyl ester; 6,9,12-Octadecatrienoic acid methyl ester; Fame 18:3n-6; Methyl (Z,Z,Z)-6,9,12-octadecatrienoateCAS: 16326-32-2Formula: C19H32O2Molecular Weight : 292.46Alternative CAS RN…
Product Name : AIDASynonym : 1-Amino-2,3-dihydro-1H-indene-1,5-dicarboxylic acid; 1-Aminoindan-1, 5-dicarboxylic acid; UPF 523CAS: 168560-79-0Formula: C11H11NO4Molecular Weight : 221.21Alternative CAS RN : –EC Number: –MDL Number : MFCD00672638Storage Temperature : –Shipping Temperature…
Product Name : 3-Acetoxy-2-methylbenzoic acidSynonym : CAS: 168899-58-9Formula: C10H10O4Molecular Weight : 194.19Alternative CAS RN : –EC Number: –MDL Number : MFCD00957176Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
640.0 0.0 72.1 73.0.0 0.0 71.9 71.0.0 0.0 -0.2 -1.131 13 1040.0 two.0 70.2 71.0.0 00 70.three 71.0.0 -2.0 0.1 0.26939.2 42.79.7 80.40.5 38.10140.6 43.78.eight 83.38.two 39.OGLD: Oral glucose-lowering drug,…
Han either is always to Gentianales , which is consistent with a phylogeny of 111 taxa based on three plasid protein-coding genes and 3 plastid non-coding regions . Nonetheless, numerous…
Product Name : N-EthylmaleimideSynonym : NEMCAS: 128-53-0Formula: C6H7NO2Molecular Weight : 125.13Alternative CAS RN : –EC Number: 204-892-4MDL Number : MFCD00005509Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 29251995Formula…
Product Name : 8-Hydroxy-2-tetraloneSynonym : CAS: 53568-05-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 2-HydroxybenzophenoneSynonym : CAS: 117-99-7Formula: C13H10O2Molecular Weight : 198.22Alternative CAS RN : –EC Number: 204-226-2MDL Number : MFCD00002216Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29145000Formula…
Product Name : 2-Chloro-4-nitrophenyl 2-azido-2-deoxy-β-D-galactopyranosideSynonym : CAS: Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,3-DiethynylbenzeneSynonym : CAS: 1785-61-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 2-Aminophenylboronic acid pinacol cyclic esterSynonym : CAS: 191171-55-8Formula: C12H18BNO2Molecular Weight : 219.09Alternative CAS RN : –EC Number: –MDL Number : MFCD02179448Storage Temperature : –Shipping Temperature : –Harmonised…
Ium for 24 h. Serum-treated hERG-HEK cells had been cultured in regular minimum necessary medium supplemented with 10 fetal bovineVOLUME 288 ?Number 21 ?May well 24,15080 JOURNAL OF BIOLOGICAL CHEMISTRYSGK1…
Lecules for rHDL plus HA treated MoDC. White: HA only treated cells; Dotted line: no stimulus. B, To examine the levels of up-regulation on the indicated surface molecules, the median…
Product Name : (R)-(-)-2-Phenylpropionic acidSynonym : CAS: 7782-26-5Formula: C9H10O2Molecular Weight : 150.18Alternative CAS RN : –EC Number: –MDL Number : MFCD00063140Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-BromobenzaldehydeSynonym : CAS: 6630-33-7Formula: C7H5BrOMolecular Weight : 185.03Alternative CAS RN : –EC Number: 229-622-2MDL Number : MFCD00003300Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 291300003-Cyclopropyl-1H-1,2,4-triazole…
Product Name : 2-Amino-5-nitro-6-picoline (2-Amino-6-methyl-5-nitropyridine)Synonym : CAS: 22280-62-2Formula: C6H7N3O2Molecular Weight : 153.14Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : CyclopentadecanolideSynonym : 1-Oxa-2-cyclohexadecanone; 15-Hydroxypentadecanoic acid lactone; 15-Pentadecanolide; PentalideCAS: 106-02-5Formula: C15H28O2Molecular Weight : 240.39Alternative CAS RN : –EC Number: 203-354-6MDL Number : MFCD00039667Storage Temperature : –Shipping Temperature :…
Product Name : Ethyl salicylateSynonym : CAS: 118-61-6Formula: C9H10O3Molecular Weight : 166.18Alternative CAS RN : –EC Number: 204-265-5MDL Number : MFCD00002215Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 3-Methylenecyclopropane-trans-1,2-dicarboxylic acid (Feist”s acid)Synonym : CAS: 499-02-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
F a standardized protocol for prevention and management of oral mucositis in sufferers undergoing hematopoietic cell transplantation. J Oncol Pharm Pract 2010, 16:195?04. 14. Wu JC, Beale KK, Ma JD:…
1000 mg/d for individuals with body weight 75 kg; nongenotype 1: 1000 mg/d for patients with physique weight 75 kg and 800 mg/d for patients with physique weight 75 kg).…
Product Name : PD-161989 2-HydroxyethanesulfonateSynonym : 1,4-Dihydro-6-methyl-7-nitro-5-(1-pyrrolodinemethyl)-2,3-quinoxaline 2-hydroxyethanesulfonic acid salt; PD-161989 2-hydroxyethanesulfonic acid salt; PD-161989 isethionate saltCAS: 186268-07-5Formula: C14H16N4O4 · C2H6O4SMolecular Weight : 430.43Alternative CAS RN : –EC Number: –MDL…
Product Name : 2,3-Dichloro-5-nitropyridineSynonym : CAS: 22353-40-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Silver(I)…
Product Name : L-Glycero-D-mannoheptoseSynonym : CAS: 4305-74-2Formula: Molecular Weight : 210.20Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Methyl…
Product Name : NonanalSynonym : Aldehyde C9; Nonyl aldehyde; PelargonaldehydeCAS: 124-19-6Formula: CH3(CH2)7CHOMolecular Weight : 142.24Alternative CAS RN : –EC Number: 204-688-5MDL Number : MFCD00007030Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 1-Bromo-3,3-dimethylbutan-2-oneSynonym : CAS: 5469-26-1Formula: C6H11BrOMolecular Weight : 179.06Alternative CAS RN : –EC Number: 226-794-0MDL Number : MFCD00000206Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff Code :…
Product Name : Lanthanum(III) nitrate hexahydrateSynonym : Lanthanum nitrate hexahydrate; Lanthanum(III) nitrate hydrateCAS: 10277-43-7Formula: La(NO3)3 · 6H2OMolecular Weight : 433.01Alternative CAS RN : –EC Number: 233-238-0MDL Number : MFCD00149751Storage Temperature…
Re measured throughout ischemia and reperfusion. Of note is that the baseline values for all of these functional parameters didn’t considerably differ at the time point I ?0, just prior…
Ds (fibre size of 152 + 5 mm and fibre spacing of 505 + 5 mm) may satisfy the specifications for long-term cell survival . Meltextrusion AM permits a fine…
Product Name : 2,5-DimethylbenzoxazoleSynonym : CAS: 5676-58-4Formula: C9H9NOMolecular Weight : 147.18Alternative CAS RN : –EC Number: 227-136-5MDL Number : MFCD00005773Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy91511-38-5…
Product Name : 3-Cyclohexenecarboxylic acidSynonym : CAS: 4771-80-6Formula: C7H10O2Molecular Weight : 126.16Alternative CAS RN : –EC Number: 225-314-7MDL Number : MFCD00013781Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-Amino-1,5-dideoxy-L-erythro-2-pentuloseSynonym : CAS: 858127-57-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-(3-Bromopyridin-4-yl)acetonitrile…
Product Name : Guanosine 5′-triphosphate, periodate oxidised sodium saltSynonym : Guanosine 5′-triphosphate-2′,3′-dialdehydeCAS: 103192-45-6Formula: C10H14N5O14P3Molecular Weight : 521.16Alternative CAS RN : –EC Number: –MDL Number : MFCD00079331Storage Temperature : -20°CShipping Temperature…
Product Name : Ginkgolic acid C13:0Synonym : 2-Hydroxy-6-tridecylbenzoic acid; 6-Tridecylsalicylic acid; Ginkgoneolic acidCAS: 20261-38-5Formula: C20H32O3Molecular Weight : 320.47Alternative CAS RN : –EC Number: –MDL Number : MFCD01661602Storage Temperature : +4°CShipping…
Product Name : (1,1”-Bis(diphenylphosphino)ferrocene)palladium(II) dichloride, complex with DichloromethaneSynonym : CAS: 95464-05-4Formula: (C17H14P)2Fe · PdCl2Molecular Weight : 731.70Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature…
Gnificantly increased in unc-13(n2609), when compared with wild form (Figure 3B2,B4). We observed similarly altered UNC-13L and UNC-10/RIM colocalization in unc-13(s69); Si(UNC-13LC2A-) animals, comparing to unc-13(s69); Si(UNC-13L) (Figure 3C1?). As…
11.0, 95 CI 4.5?three.7; P0.01), Oceania (AOR 4.9, 95 CI two.9?.0; P0.01) and East Africa (AOR 3.five, 95 CI 1.5?.eight; P0.01)9. The number of African-born Americans within the SEER research…
Product Name : 1-EBIOSynonym : 1-Ethyl-1,3-dihydro-2H-benzimidazol-2-one; 1-EthylbenzimidazolinoneCAS: 10045-45-1Formula: C9H10N2OMolecular Weight : 162.19Alternative CAS RN : –EC Number: 233-148-1MDL Number : MFCD00005715Storage Temperature : +20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Chloro-4-trifluoromethylphenylboronic acidSynonym : CAS: 254993-59-4Formula: C7H5BClF3O2Molecular Weight : 224.38Alternative CAS RN : –EC Number: –MDL Number : MFCD02684337Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Dextrorphan tartrateSynonym : (+)-3-Hydroxy-N-methylmorphinan (+)-tartrate salt; Dextrorphan D-tartrateCAS: 143-98-6Formula: C17H23NO · C4H6O6Molecular Weight : 407.46Alternative CAS RN : 125-73-5EC Number: –MDL Number : –Storage Temperature : –Shipping…
Product Name : Itaconic anhydrideSynonym : 2-Methylenesuccinic anhydride; 3,4-Dihydro-3-methylene-2,5-furandioneCAS: 2170-03-8Formula: C5H4O3Molecular Weight : 112.09Alternative CAS RN : –EC Number: 218-518-2MDL Number : MFCD00005530Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : N,N,Dimethylformamide, 99.5%Synonym : DMFCAS: 68-12-2Formula: C3H7NOMolecular Weight : 73.09Alternative CAS RN : –EC Number: 200-679-5MDL Number : MFCD00003284Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : MyrceneSynonym : β-Myrcene; 7-Methyl-3-methylene-1,6-octadieneCAS: 123-35-3Formula: C10H16Molecular Weight : 136.23Alternative CAS RN : –EC Number: 204-622-5MDL Number : MFCD00008908Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Roliferation ability in vitro. This might be attributed towards the reality that a different “chemical environment” with altered secretion of cytokines inside the disc causes resident progenitor cells to proliferate…
Ing the accumulation of macrophagederived cholesterol in plasma, the level of 3H-cholesterol within this compartment at 24 and 48 hours is significantly reduced in CETP transgenic mice and also the…
Product Name : Gallic acid, anhydrousSynonym : 3,4,5-Trihydroxybenzoic acid; Gallic acid anhydrousCAS: 149-91-7Formula: C7H6O5Molecular Weight : 170.12Alternative CAS RN : 5995-86-8 (·H2O), 732304-20-0EC Number: 205-749-9MDL Number : MFCD00002510Storage Temperature :…
Product Name : Cellulose acetate phthalateSynonym : CAPCAS: 9004-38-0Formula: C116H116O64Molecular Weight : 2534.12Alternative CAS RN : –EC Number: –MDL Number : MFCD00072769Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 3-Chloroperoxybenzoic acid, 70%Synonym : MCPBACAS: 937-14-4Formula: C7H5ClO3Molecular Weight : 172.57Alternative CAS RN : –EC Number: 213-322-3MDL Number : MFCD00002127Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : Diethyl etherSynonym : CAS: 60-29-7Formula: C4H10OMolecular Weight : 74.12Alternative CAS RN : –EC Number: 200-467-2MDL Number : MFCD00011646Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : L-N6-(1-Iminoethyl)lysine dihydrochlorideSynonym : L-Lysine ω-acetamidine dihydrochloride; L-NIL dihydrochlorideCAS: 159190-45-1Formula: C8H17N3O2 · 2 HClMolecular Weight : 260.16Alternative CAS RN : –EC Number: –MDL Number : MFCD00270890Storage Temperature :…
Product Name : L-Lysine 7-amido-4-methylcoumarin acetate saltSynonym : L-Lysine-AMC. 1025796-31-9 Purity 123958-87-2 In stock AcetateCAS: 201853-23-8Formula: C18H25N3O5Molecular Weight : 363.40Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature…
Od for systemic transplanting Tregs is safe and uncomplicated to carry out. In conclusion, transplantation of purified autologous Tregs right after UC-MSCs education in vitro might be a extra desirable…
Cript NIH-PA Author Manuscript NIH-PA Author ManuscriptSupplementary MaterialRefer to Net version on PubMed Central for supplementary material.AcknowledgmentsSupported by NIH grants CA156330, U54 AI057157, R37-AI029564 and P01DK094779 (J.P.-Y.T); AI088255 (J.A.D) and…
Product Name : Stearic acid, pure, 98%Synonym : 1-Heptadecanecarboxylic acid; C18:0; Cetylacetic acid; NSC 25956; NSC 261168; Octadecanoic acid; Stearophanic acidCAS: 57-11-4Formula: C18H36O2Molecular Weight : 284.48Alternative CAS RN : –EC…
Product Name : 2-Amino-3,5-dibromobenzaldehydeSynonym : CAS: 50910-55-9Formula: C7H5Br2NOMolecular Weight : 278.93Alternative CAS RN : –EC Number: 256-841-0MDL Number : MFCD00671100Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy12135-22-7…
Product Name : cis-Cyclobutane-1,2-dicarboxylic acidSynonym : CAS: 1461-94-5Formula: C6H8O4Molecular Weight : 144.13Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : PorphobilinogenSynonym : CAS: 487-90-1Formula: C10H14N2O4Molecular Weight : 226.23Alternative CAS RN : –EC Number: 207-666-3MDL Number : –Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff Code :…
Product Name : 5-Chloro-2-hydroxypyridine (5-Chloro-2-pyridinol)Synonym : CAS: 4214-79-3Formula: C5H4ClNOMolecular Weight : 129.55Alternative CAS RN : –EC Number: 224-146-1MDL Number : MFCD00006275Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Phenylsuccinic acidSynonym : PSA; Phenyl succinic acid; (±)-Phenylsuccinic acid; DL-Phenylsuccinic acidCAS: 635-51-8Formula: C10H10O4Molecular Weight : 194.19Alternative CAS RN : 10424-29-0EC Number: 211-238-1MDL Number : MFCD00004256Storage Temperature :…
He simultaneous export of SA and 3-indoleacetic acid (IAA), the latter used here as an unspecific control, from loaded complete mesophyll protoplasts. In agreement with the results obtained so far,…
Atasets referenced in and (n.s.; non-significant). * p,0.05, ** p,0.01 in Student’s t test. Error bars represent the 6 imply SEM. doi:10.1371/journal.pgen.1003483.gembedding in paraffin for histological evaluation. For lipid, protein…
Product Name : Sodium hexanoateSynonym : Caproic acid sodium salt; Hexanoic acid sodium salt; Sodium caproateCAS: 10051-44-2Formula: CH3(CH2)4COONaMolecular Weight : 138.14Alternative CAS RN : –EC Number: 233-179-0MDL Number : MFCD00059056Storage…
Product Name : Diethyl 1,3-acetonedicarboxylateSynonym : CAS: 105-50-0Formula: C9H14O5Molecular Weight : 202.21Alternative CAS RN : –EC Number: 203-302-2MDL Number : MFCD00009200Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,5-DihydroxybenzaldehydeSynonym : CAS: 1194-98-5Formula: C7H6O3Molecular Weight : 138.12Alternative CAS RN : –EC Number: 214-789-6MDL Number : MFCD00003333Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –106-86-5…
Product Name : Ammonium hexafluorotitanateSynonym : CAS: 16962-40-6Formula: (NH4)2TiF6Molecular Weight : 197.95Alternative CAS RN : –EC Number: 241-036-9MDL Number : MFCD00010888Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Fluoro-5-nitropyridineSynonym : CAS: 456-24-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1459778-94-9…
Product Name : Methyl D-galactopyranosideSynonym : CAS: 93302-26-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
EthodsReagentsA pan-PKC inhibitor (GF109203X), MEK1/2 inhibitor (U0126), p38 MAPK inhibitor (SB203580), and PI3K inhibitor (LY294002) have been purchased from CalbiochemNovabiochem Corporation (San Diego, CA). JNK inhibitor (SP600125) and NF-B inhibitor…
E-aged population . The Korea Centers for Illness Manage and Prevention is focusing on the rising trend of hepatitis C and has included this disease in the Korea National Overall…
Product Name : Zinc sulfate heptahydrateSynonym : Zinc sulphate hydrate; Zinc sulphate heptahydrateCAS: 7446-20-0Formula: ZnSO4 · 7H2OMolecular Weight : 287.54Alternative CAS RN : 7446-19-7 (·H2O), 7733-02-0 (anhyr.)EC Number: 231-793-3MDL Number…
Product Name : 2-Chloro-5-chloromethylpyridineSynonym : CAS: 70258-18-3Formula: C6H5Cl2NMolecular Weight : 162.02Alternative CAS RN : –EC Number: –MDL Number : MFCD00125366Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2647503-30-6…
Product Name : 2-Methyl-4-nitrophenol (4-Nitro-o-cresol)Synonym : CAS: 99-53-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : SuccinimideSynonym : 2,5-PyrrolidinedioneCAS: 123-56-8Formula: C4H5NO2Molecular Weight : 99.09Alternative CAS RN : –EC Number: 204-635-6MDL Number : MFCD00005495Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292519956-Chloroquinoline-2-carboxylic…
Product Name : Bismuth(lll) chlorideSynonym : CAS: 7787-60-2Formula: BiCl3Molecular Weight : 315.34Alternative CAS RN : –EC Number: 232-123-2MDL Number : MFCD00003461Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-Fluoro-5-nitro-3-picoline (2-Fluoro-3-methyl-5-nitropyridine)Synonym : CAS: 19346-46-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
C1300 cells had been grown without having antibiotic. Neuro2A cells expressing the LAT area from LAT nt 361 to 1499 were described previously (44) and grown as described above but…
MaterialRefer to Web version on PubMed Central for supplementary material.AcknowledgmentsWe thank our colleagues, in particular Larry Marnett (Vanderbilt) for precious discussions and/or careful reading on the manuscript. We’re indebted to…
Product Name : 2,3,4-Tri-O-acetyl-α-D-glucuronide methyl ester trichloroacetimidateSynonym : CAS: 92420-89-8Formula: Molecular Weight : 478.66Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff…
Product Name : 3,4-Dihydroxybenzoic acidSynonym : Protocatechuic acid; Catechol-4-carboxylic acid; Pyrocatechol-4-carboxylic acidCAS: 99-50-3Formula: C7H6O4Molecular Weight : 154.12Alternative CAS RN : –EC Number: 202-760-0MDL Number : MFCD00002509Storage Temperature : +20°CShipping Temperature…
Product Name : L-Glutamic acid gamma-(3-carboxy-4- nitroanilide) ASynonym : CAS: 63699-78-5Formula: C12H12N3O7NH4Molecular Weight : 328.28Alternative CAS RN : –EC Number: 264-418-7MDL Number : –Storage Temperature : +4°CShipping Temperature : AmbientHarmonised…
Product Name : 5-Amino-2-methylpyridine (5-Amino-2-picoline)Synonym : CAS: 3430-14-6Formula: C6H8N2Molecular Weight : 108.14Alternative CAS RN : –EC Number: –MDL Number : MFCD00833389Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : (S)-(+)-2-Phenylpropionic acidSynonym : CAS: 7782-24-3Formula: C9H10O2Molecular Weight : 150.18Alternative CAS RN : –EC Number: –MDL Number : MFCD00063139Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : PanipenemSynonym : CAS: 87726-17-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29419000N-Boc-PEG4-bromide…
From the SN and VTA. It has been reported that the MEK1/2 inhibitor, U0126, also blocks MEK5 phosphorylation, thereby inhibiting ERK1, 2, and 5 activities (Cavanaugh et al., 2006; Kamakura…
Ith DAPI (blue) for nucleus and antibodies against LC3 (green) for autophagosomes; punctuated LC3 dots have been deemed as good outcomes. Pictures are at 10009. (D) The corresponding linear diagram…
Product Name : Tetrapropylammonium iodideSynonym : CAS: 631-40-3Formula: (CH3CH2CH2)4NIMolecular Weight : 313.27Alternative CAS RN : –EC Number: 211-157-1MDL Number : MFCD00011842Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : N-Acetyl-D-galactosaminitolSynonym : 2-Acetamido-2-deoxy-D-galactitolCAS: 10486-91-6Formula: C8H17NO6Molecular Weight : 223.22Alternative CAS RN : –EC Number: –MDL Number : MFCD00133566Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy334951-61-0…
Product Name : 3,4-DimethylbenzaldehydeSynonym : CAS: 5973-71-7Formula: C9H10OMolecular Weight : 134.18Alternative CAS RN : –EC Number: 227-770-2MDL Number : MFCD00016612Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 2912290060Price…
Product Name : Trans-5-decenyl acetateSynonym : CAS: 38421-90-8Formula: C12H22O2Molecular Weight : 198.30Alternative CAS RN : –EC Number: 253-923-8MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Methyl 2-aminobenzoateSynonym : Methyl anthranilateCAS: 134-20-3Formula: C8H9NO2Molecular Weight : 151.17Alternative CAS RN : –EC Number: 205-132-4MDL Number : MFCD00007710Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : Lawesson reagentSynonym : p-Methoxyphenylthionophosphine sulfide dimer; 2,4-Bis(4-methoxyphenyl)-2,4-dithioxo-1,3,2,4-dithiadiphosphetane; 4-Methoxyphenylthiophosphoric cyclic di(thioanhydride)CAS: 19172-47-5Formula: C14H14O2P2S4Molecular Weight : 404.47Alternative CAS RN : –EC Number: 242-855-4MDL Number : MFCD00005171Storage Temperature : +20°CShipping…
Lue populations of HuES7 to establish functional pluripotency. Information are from 3 independent biological replicates; error bars indicate the SD. **p 0.01. EB-HB, EBs from higher blue population; EB-UN, EBs…
Ubtype Bulky/ non-bulky Fantastic GO1 outcome GO2 GO3 GO4 GO5 GO6 GO7 GO8 GO9 GO10 GO11 GO12 Poor PO1 outcome PO2 (CN) PO3 PO4 PO5 PO6 Poor PO1 outcome (CE)…
Product Name : N-PhenylthioureaSynonym : 1-Phenyl-2-thiourea; PTU; PhenylthiocarbamideCAS: 103-85-5Formula: C7H8N2SMolecular Weight : 152.21Alternative CAS RN : –EC Number: 203-151-2MDL Number : MFCD00004933Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 7-AzaindoleSynonym : 1H-PyrrolopyridineCAS: 271-63-6Formula: C7H6N2Molecular Weight : 118.14Alternative CAS RN : –EC Number: 205-981-0MDL Number : MFCD00005606Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29339980Price…
Product Name : Mefenamic acid acyl-β-D-glucuronideSynonym : CAS: 102623-18-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : L-655,708Synonym : Ethyl (S)-11,12,13,13a-Tetrahydro-7-methoxy-9-oxo-9H-imidazopyrrolobenzodiazepine-1-carboxylate; L-655708CAS: 130477-52-0Formula: C18H19N3O4Molecular Weight : 341.36Alternative CAS RN : –EC Number: –MDL Number : MFCD02684528Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : Behenic acid, 85%Synonym : Docosanoic acidCAS: 112-85-6Formula: C22H44O2Molecular Weight : 340.60Alternative CAS RN : –EC Number: 204-010-8MDL Number : MFCD00002807Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 2,4,6-TrifluorophenolSynonym : CAS: 2268-17-9Formula: C6H3F3OMolecular Weight : 148.09Alternative CAS RN : –EC Number: –MDL Number : MFCD00061216Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Sodium…
Ethods: The study group was formed of 60 consecutive ADHD individuals and 30 healthy kids. IgG levels for VZV; HSV-1, CMV, Measles, Mumps, Rubella and EBV had been evaluated. Results:…
Ructure. Earlier report suggests that UIMs motif of RAP80 is located in equilibrium amongst a-helix and random structure . DE81 mutation possibly alters the a-helical conformation of RAP80 UIMs which…
Product Name : p-TolunitrileSynonym : CAS: 104-85-8Formula: C8H7NMolecular Weight : 117.15Alternative CAS RN : –EC Number: 203-244-8MDL Number : MFCD00001827Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292690955-Iodo-2-methylthiazole…
Product Name : 2-(Ethylthio)phenylboronic acidSynonym : CAS: 362045-33-8Formula: C8H11BO2SMolecular Weight : 182.04Alternative CAS RN : –EC Number: –MDL Number : MFCD03095256Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methyl-1-tetraloneSynonym : CAS: 19832-98-5Formula: C11H12OMolecular Weight : 160.22Alternative CAS RN : –EC Number: 243-355-9MDL Number : MFCD00001691Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29143900Methyl…
Product Name : 3-Bromo-2-chloropyridineSynonym : CAS: 52200-48-3Formula: C5H3BrClNMolecular Weight : 192.44Alternative CAS RN : –EC Number: –MDL Number : MFCD00234007Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Buy53902-76-4…
Product Name : 5-CyanophthalideSynonym : CAS: 82104-74-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293220901020665-73-9…
Product Name : 6-Deoxy-8-O-methylrabelomycinSynonym : (R)-3-Hydroxy-8-methoxy-3-methyl-3,4-dihydro-tetraphene-1,7,12(2H)-trione; MM 47755CAS: 117620-87-8Formula: C20H16O5Molecular Weight : 336.3Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code…
P3+ Treg cells, and M2 microglia. HSV1 latency occurs when HDAC maintains chromatin in an inactive state permitting IFN- developed by NK cells and non-cytolytic CD8+ T cells to exert…
Ull advantage of:?Easy on the web submission ?Thorough peer overview ?No space constraints or color figure charges ?Quick publication on acceptance ?Inclusion in PubMed, CAS, Scopus and Google Scholar ?Investigation…
Product Name : 4-Benzyloxyphenylacetic acidSynonym : CAS: 6547-53-1Formula: C15H14O3Molecular Weight : 242.28Alternative CAS RN : –EC Number: 229-463-9MDL Number : MFCD00017540Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : DigitoxigeninSynonym : 3β,14-Dihydroxy-5β,20(22)-cardenolide; 3,14,21-Trihydroxy-20(22)-norcholenic acid lactone; 5β,20(22)-Cardenolide-3β,14-diolCAS: 143-62-4Formula: C23H34O4Molecular Weight : 374.51Alternative CAS RN : –EC Number: 205-603-4MDL Number : MFCD00003687Storage Temperature : –Shipping Temperature : –Harmonised…
Product Name : Propargyl β-D-lactoside heptaacetateSynonym : CAS: 211688-85-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 2-Chloro-3-trifluoromethylpyridineSynonym : CAS: 65753-47-1Formula: C6H3ClF3NMolecular Weight : 181.55Alternative CAS RN : –EC Number: 424-520-6MDL Number : MFCD00042223Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –6-Chloro-1H-pyrazolopyridine…
Product Name : TriethylamineSynonym : CAS: 121-44-8Formula: C6H15NMolecular Weight : 101.19Alternative CAS RN : –EC Number: 204-469-4MDL Number : MFCD00009051Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292119998-Hydroxyjulolidine…
Product Name : 1-Fluoro-3-nitrobenzeneSynonym : CAS: 402-67-5Formula: C6H4FNO2Molecular Weight : 141.10Alternative CAS RN : –EC Number: 206-953-0MDL Number : MFCD00007196Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290490956-Methoxy-5-nitropicolinic…
Pears that, in asymmetric hydrogenations, Walphos ligands and their biferrocene analogues show drastically various performances. This obtaining becomes much more apparent when, as well as ee values, the absolute configurations…
G quantitation for DAGs. Total DAG levels had been calculated as a sum of person species. Immunoblot evaluation of protein kinase C (PKC) isoforms Heart tissues (one hundred mg) from…
Product Name : 2-Amino-4-methoxypyridineSynonym : CAS: 10201-73-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyBis(cyclooctadiene)dichlorodirhodium…
Product Name : CP-380736Synonym : 6,7-Bis(2-methoxyethoxy)-3,4-dihydroquinazolin-4-one; 6,7-Bis(2-methoxyethoxy)-4(3H)-quinazolinone; PF-00520893CAS: 179688-29-0Formula: C14H18N2O5Molecular Weight : 294.30Alternative CAS RN : –EC Number: –MDL Number : MFCD02678087Storage Temperature : +20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 4-(Methylthio)benzaldehydeSynonym : 4-(Methylmercapto)benzaldehydeCAS: 3446-89-7Formula: C8H8OSMolecular Weight : 152.22Alternative CAS RN : –EC Number: 222-365-7MDL Number : MFCD00006948Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29309099194726-46-0…
Product Name : 4-Hydroxy-1-indanoneSynonym : CAS: 40731-98-4Formula: C9H8O2Molecular Weight : 148.16Alternative CAS RN : –EC Number: –MDL Number : MFCD00143330Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 4-Fluorobenzyl alcoholSynonym : CAS: 459-56-3Formula: C7H7FOMolecular Weight : 126.13Alternative CAS RN : –EC Number: 207-292-0MDL Number : MFCD00004651Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Hydrazine acetateSynonym : CAS: 7335-65-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Ls; NFB, Nuclear aspect kappa B.Discussion FN has a variety of biological activities involved in cell adhesion, migration, cytoskeletal organization, proliferation and differentiation . Thrombin has different biological effects also…
, is predominantly taken up and metabolized by astrocytes.19,20 Consequently, injection of glucose and acetate used in conjunction with 13C NMR spectroscopy permits monitoring of your activity of metabolic pathways…
Product Name : 4-Methylumbelliferyl a-L-idopyranosideSynonym : CAS: 66901-41-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Indole-2-acetic acidSynonym : CAS: 32588-36-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-ChlorolepidineSynonym : CAS: 634-47-9Formula: C10H8ClNMolecular Weight : 177.63Alternative CAS RN : –EC Number: 211-209-3MDL Number : MFCD00006742Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293349901135283-50-9…
Product Name : Methyl 4-amino-2-methoxybenzoateSynonym : CAS: 27492-84-8Formula: C9H11NO3Molecular Weight : 181.19Alternative CAS RN : –EC Number: 248-494-9MDL Number : MFCD00017202Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Chloro-2-fluorobenzonitrileSynonym : CAS: 57381-51-8Formula: C7H3ClFNMolecular Weight : 155.56Alternative CAS RN : –EC Number: 260-712-4MDL Number : MFCD00143284Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2647503-30-6…
Product Name : (Phenylsulfonyl)acetonitrileSynonym : CAS: 7605-28-9Formula: C8H7NO2SMolecular Weight : 181.22Alternative CAS RN : –EC Number: 231-515-0MDL Number : MFCD00007550Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29309099Price…
150 ns, which is often a further indicator of simulation convergence . It holds in the level of ca. 85 for the OPLSAA force field and ca. 60 for Amber99sb…
Micksche M: Probiotic, too as conventional yogurt, can boost the stimulated production of proinflammatory cytokines. J Hum Nutr Diet plan 2007, 20(six):590?98. 19. Moorthy G, Murali MR, Devaraj SN: Protective…
Product Name : Didecyldimethylammonium chlorideSynonym : Didecyl dimethyl ammonium chloride; N-Decyl-N,N-dimethyl-1-decanaminium chloride; DDAC; DidecyldimethylammoniumchlorideCAS: 7173-51-5Formula: C22H48ClNMolecular Weight : 362.08Alternative CAS RN : –EC Number: –MDL Number : MFCD00066262Storage Temperature :…
Product Name : Sodium tauroglycocholateSynonym : CAS: 41945-48-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : trans-2-HexenalSynonym : CAS: 6728-26-3Formula: C6H10OMolecular Weight : 98.15Alternative CAS RN : –EC Number: 229-778-1MDL Number : MFCD00007008Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 291219002,4-Dichloro-6-ethoxyquinazoline…
Product Name : Piperonyloyl chlorideSynonym : CAS: 25054-53-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3”-FluoroacetanilideSynonym : CAS: 351-28-0Formula: C8H8FNOMolecular Weight : 153.16Alternative CAS RN : –EC Number: 206-509-6MDL Number : MFCD00017917Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2649788-76-9…
Product Name : 1,2,3,4-Tetra-O-acetyl-6-azido-L-fucopyranoseSynonym : CAS: 912478-17-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Rangement that generates a fusion transcript with the activation domain of STAT6 and the adjacent gene, NAB2, has been identified in solitary fibrous tumors . This fusion, which induces proliferation…
Within a chemically-induced colitis model differs substantially from initiation via infection-induced inflammation. The effects of dietary fish oil in models of colitis that incorporate genetic and environmental (bacteria) threat aspects…
Product Name : Silver nitrateSynonym : Nitric acid silver(I) saltCAS: 7761-88-8Formula: AgNO3Molecular Weight : 169.88Alternative CAS RN : –EC Number: 231-853-9MDL Number : MFCD00003397Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 1-Allyl-3,7-dimethyl-8-sulfophenylxanthineSynonym : CAS: 149981-25-9Formula: C16H16N4O5SMolecular Weight : 376.39Alternative CAS RN : –EC Number: –MDL Number : MFCD00083167Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : Indole-7-acetonitrileSynonym : CAS: 82199-98-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –BuyDimethyl…
Product Name : 3H-1,2-Benzodithiol-3-one-1,1-dioxideSynonym : Beaucage ReagentCAS: 66304-01-6Formula: C7H4O3S2Molecular Weight : 200.24Alternative CAS RN : –EC Number: –MDL Number : MFCD00132960Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-Ethoxy-1-naphthoic acidSynonym : CAS: 2224-00-2Formula: C13H12O3Molecular Weight : 216.24Alternative CAS RN : –EC Number: 218-745-7MDL Number : MFCD00004008Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Calmodulin-dependent Protein Kinase II fragment 290-309Synonym : CaM kinase II (290-309)CAS: 115044-69-4Formula: C103H185N31O24SMolecular Weight : 2273.83Alternative CAS RN : –EC Number: –MDL Number : MFCD00076719Storage Temperature :…
For two min, incubated in epitope retrieval remedy (Leica) at 70 C for two min and treated using the blocking reagent (four BSA, ten regular goat serum, in PBS with…
6 3.98 99.50 ?0.48 3.97 99.20 ?0.33 four.01 100.20 ?0.61 five.95 99.20 ?0.92 five.99 99.80 ?0.65 5.96 99.30 ?0.84 10.04 one hundred.40 ?1.17 ten.01 100.10 ?0.93 9.95 99.50 ?1.07 9.91…
Product Name : 3-Buten-1-olSynonym : CAS: 627-27-0Formula: CH2=CHCH2CH2OHMolecular Weight : 72.11Alternative CAS RN : –EC Number: 210-991-3MDL Number : MFCD00002959Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –53103-03-0…
Product Name : Benzyltrimethylammonium dichloroiodateSynonym : CAS: 114971-52-7Formula: C10H16NICl2Molecular Weight : 348.06Alternative CAS RN : –EC Number: –MDL Number : MFCD00075259Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 7-Bromo-6-chloro-quinazoline-4(3H)-oneSynonym : CAS: 17518-98-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 2-Chloroethyl-2,3,4,6-tetra-O-acetyl-a-D-mannopyranosideSynonym : CAS: 849420-02-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 4-Dimethylamino-2-methoxybenzaldehydeSynonym : CAS: 84562-48-1Formula: C10H13NO2Molecular Weight : 179.22Alternative CAS RN : –EC Number: –MDL Number : MFCD00151814Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292250001-(1H-indol-3-yl)-2-methylpropan-2-amine…
Product Name : Sodium methoxideSynonym : Sodium methylateCAS: 124-41-4Formula: CH3ONaMolecular Weight : 54.02Alternative CAS RN : –EC Number: 204-699-5MDL Number : MFCD00012179Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Ile species have been observed to have the greatest influence on soil chemical composition variability. The influence from the Hg water soluble fraction was weak, though inside the perimeter of…
Histocompatibility complicated : TNF, LT, and LT. TNF is developed as a membrane bound molecule that is definitely clipped by the TNF converting enzyme (TACE) to be released as a…
Product Name : (R)-(+)-3-Hydroxy-gamma-butyrolactoneSynonym : CAS: 58081-05-3Formula: C4H6O3Molecular Weight : 102.09Alternative CAS RN : –EC Number: –MDL Number : MFCD00211248Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : –2206737-78-0…
Product Name : Aristolochic acid I sodium saltSynonym : Aristolochic acid sodium saltCAS: 10190-99-5Formula: C17H10NNaO7Molecular Weight : 363.25Alternative CAS RN : –EC Number: 233-463-4MDL Number : MFCD00210760Storage Temperature : –Shipping…
Product Name : 2-(Fluorosulfonyl)difluoroacetic acidSynonym : CAS: 1717-59-5Formula: FSO2CF2CO2HMolecular Weight : 178.09Alternative CAS RN : –EC Number: –MDL Number : MFCD01320807Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Tetrahydrothiophen-3-oneSynonym : CAS: 1003-04-9Formula: C4H6OSMolecular Weight : 102.16Alternative CAS RN : –EC Number: 213-698-9MDL Number : MFCD00005412Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –958451-91-7…
Product Name : 3,5-Difluorophenylboronic acidSynonym : CAS: 156545-07-2Formula: C6H5BF2O2Molecular Weight : 157.91Alternative CAS RN : –EC Number: –MDL Number : MFCD01318138Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 1H-Indole-2,5-dicarboxylic acid (5-Carboxyindole-2-carboxylic acid)Synonym : CAS: 117140-77-9Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
D, Delgado ML, Schweich D (2009) Adsorption of complicated phenolic compounds on active charcoal: Adsorption capacity and isotherms. Chemical Engineering Journal 148(1):1? Smisek M, Cerny S (1970) Active Carbon. Manufacture,…
Res, speedy sequence induction, cricoid stress, duration of surgery, and inability to extubate inside the OR (Table 6). The postoperative length of remain didn’t correlate with esophagogastric dysfunction, intestinal dysmotility,…
Product Name : 5-Fluoro-2,4-dichloropyrimidineSynonym : CAS: 2927-71-1Formula: C4HCl2FN2Molecular Weight : 166.97Alternative CAS RN : –EC Number: –MDL Number : MFCD00233551Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29335995900Methyl…
Product Name : Methylaminoformyl chlorideSynonym : CAS: 6452-47-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-Methyl 2-nitroterephthalateSynonym : CAS: 35092-89-8Formula: C9H7NO6Molecular Weight : 225.17Alternative CAS RN : –EC Number: 252-360-5MDL Number : MFCD00024510Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 6-O-FeruloylsucroseSynonym : CAS: 137941-45-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –N-Methylmaleimide…
Product Name : Rp-2′-O-Monobutyryladenosine 3′,5′-cyclic monophosphorothioateSynonym : Rp-2′-O-MB-cAMPSCAS: 152218-23-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : Benzyl chloromethyletherSynonym : CAS: 3587-60-8Formula: C8H9ClOMolecular Weight : 156.61Alternative CAS RN : –EC Number: –MDL Number : MFCD00000886Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
8; Shaw, Gross, Moilanen, Sameroff, 2009). As outlined above, both maternal depression and damaging parenting, as an example harsh parenting, have already been linked to unfavorable outcomes with respect to…
Ng pri mary antibodies had been utilised: an antiALP monoclonal mouse antibody (Sigma-Aldrich) and an antitype I collagen polyclonal goat antibody (Santa Cruz Biotechnology, CA, USA). The antigen-antibody complex was…
Product Name : Picolinic acid 99% solutionSynonym : CAS: 98-98-6Formula: C6H5NO2Molecular Weight : 123.11Alternative CAS RN : –EC Number: 202-719-7MDL Number : MFCD00006293Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : 4-Fluorophenacyl bromideSynonym : ω-Bromo-4-fluoroacetophenoneCAS: 403-29-2Formula: C8H6BrFOMolecular Weight : 217.04Alternative CAS RN : –EC Number: 206-955-1MDL Number : MFCD00040830Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2,4-DichloropyridineSynonym : CAS: 26452-80-2Formula: C5H3Cl2NMolecular Weight : 147.99Alternative CAS RN : –EC Number: 247-717-7MDL Number : MFCD00955618Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1,2,3,5,6,7-Hexahydro-s-indacene…
Product Name : 2-AminothiophenolSynonym : CAS: 137-07-5Formula: C6H7NSMolecular Weight : 125.19Alternative CAS RN : –EC Number: 205-277-3MDL Number : MFCD00007702Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293090992-Iodo-1,3,5-trimethoxybenzene…
Product Name : 2,4-Dimethylphenylboronic acidSynonym : CAS: 55499-44-0Formula: C8H11BO2Molecular Weight : 149.99Alternative CAS RN : –EC Number: –MDL Number : MFCD02683101Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Trimethylacetic anhydrideSynonym : CAS: 1538-75-6Formula: C10H18O3Molecular Weight : 186.25Alternative CAS RN : –EC Number: 216-263-1MDL Number : MFCD00008842Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
T the time of your follow-up surgery, as determined by dividing the length from the incision related with adhesions (cm) by the all round initial midline incision length (cm). ?Mobilization…
22 23 24 25 SNPs 126 100 105 140 152 120 234 123 124 130 116 one hundred 89 101 158 96 163 139 113 148 135 152 122 103…
Product Name : 3,4,5-Trimethoxyphenyl boronic acidSynonym : CAS: 182163-96-8Formula: C9H13BO5Molecular Weight : 212.01Alternative CAS RN : –EC Number: –MDL Number : MFCD01075676Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : TetramethylthioureaSynonym : CAS: 2782-91-4Formula: C5H12N2SMolecular Weight : 132.23Alternative CAS RN : –EC Number: 220-488-0MDL Number : MFCD00008324Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293090992-Octyldecanoic…
Product Name : 2-Bromo-2-methylpropionyl bromideSynonym : CAS: 20769-85-1Formula: C4H6Br2OMolecular Weight : 229.91Alternative CAS RN : –EC Number: 244-017-3MDL Number : MFCD00000122Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Methyl 2,3,4-tri-O-benzyl-6-O-tert-butyldiphenylsilyl-a-D-mannopyranosideSynonym : CAS: 186540-03-4Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Aminobenzonitrile (Anthranilonitrile)Synonym : CAS: 1885-29-6Formula: C7H6N2Molecular Weight : 118.14Alternative CAS RN : –EC Number: 217-549-9MDL Number : MFCD00007631Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : AMD3100 octahydrochloride hydrateSynonym : 1,1′-bis-1,4,8,11-tetraazacyclotetradecane octahydrochloride; JM3100; Plerixafor; SID791; 1,1′--bis-(1,4,8,11-tetraazacyclotetradecane) octahydrochloride; AMD 3100 octahydrochloride hydrateCAS: 155148-31-5Formula: C28H54N8 · 8HCl · xH2OMolecular Weight : 794.47 (anhydrous)Alternative CAS RN…
, version 8.two (SAS Institute, Inc., Cary, NC, USA).White Black Asian Other Area, n ( ) Usa Europe Latin America AsiaResults The ITT population integrated 1184 adult individuals, of whom…
U of RNase T1 per ml of cell lysate) and RNase V1 (which cleaves3808 Nucleic Acids Study, 2013, Vol. 41, No.(a)(b)(c)(e)(d)Figure 1. Prp8-binding sites on U5 snRNA. (a) Left: A…
Product Name : alpha-Phenyl-alpha-(2-pyridyl)-acetonitrileSynonym : CAS: 5005-36-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999N-Cyano-2-pyridinecarboximidamide…
Product Name : Oxalic acid dihydrateSynonym : Ethanedioic acid dihydrateCAS: 6153-56-6Formula: C2H2O4 · 2H2OMolecular Weight : 126.07Alternative CAS RN : 144-62-7 (anhydrous)EC Number: 205-634-3MDL Number : MFCD00149102Storage Temperature : +20°CShipping…
Product Name : 4-(Trifluoromethyl)-1-indanoneSynonym : CAS: 68755-42-0Formula: C10H7F3OMolecular Weight : 200.16Alternative CAS RN : –EC Number: –MDL Number : MFCD07772121Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Amino-2-thiazolin-5-one…
Product Name : Ethyl (R)-(-)-3-hydroxybutyrateSynonym : CAS: 24915-95-5Formula: C6H12O3Molecular Weight : 132.16Alternative CAS RN : –EC Number: –MDL Number : MFCD00075386Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Ginkgolic acidSynonym : 6-salicylic acid; Ginkgolic acid II; Ginkgolic acid C17:1CAS: 111047-30-4Formula: C24H38O3Molecular Weight : 374.56Alternative CAS RN : –EC Number: –MDL Number : MFCD09752804Storage Temperature :…
Product Name : (-)-Scopolamine methyl bromideSynonym : Hyoscine methyl bromide; Methscopolamine bromide; (−)-Scopolamine methyl bromideCAS: 155-41-9Formula: C18H24NO4 · BrMolecular Weight : 398.29Alternative CAS RN : –EC Number: 205-844-5MDL Number :…
1?.42 vs. 49.66?.four, P0.05; 69?.2 vs. 97?1.two, P0.05), respectively. As shown in Figures 7 and eight, P. harmala elevated testosterone and DHEA-S (0.45?.08 vs. 0.25?.03, P0.05; 0.9?.07 vs. 0.6?.08, P0.05)…
In UV-treated cells with a CSB-deficient background, and deleting the ATF/CRE website allows luciferase expression (Fig. 4 G and H); and (ii) siRNA-mediated knockdown of ATF3 releases the repression of…
Product Name : 6-NitrocoumarinSynonym : CAS: 2725-81-7Formula: C9H5NO4Molecular Weight : 191.14Alternative CAS RN : –EC Number: 220-341-0MDL Number : MFCD00016973Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –204376-48-7…
Product Name : 2,3:5,6-Di-O-isopropylidene-D-talonoic acid-1,4-lactoneSynonym : CAS: 23262-80-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methyl-3-nitrobenzoic acidSynonym : CAS: 96-98-0Formula: C8H7NO4Molecular Weight : 181.15Alternative CAS RN : –EC Number: 202-549-3MDL Number : MFCD00007174Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,2-DichloroacetophenoneSynonym : CAS: 2648-61-5Formula: C8H6Cl2OMolecular Weight : 189.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00000844Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29147000(3-Bromo-1-propyn-1-yl)cyclopropane…
Product Name : Piperonylic acidSynonym : CAS: 94-53-1Formula: C8H6O4Molecular Weight : 166.13Alternative CAS RN : –EC Number: 202-342-8MDL Number : MFCD00005830Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 2,6-DichlorobenzonitrileSynonym : CAS: 1194-65-6Formula: C7H3Cl2NMolecular Weight : 172.01Alternative CAS RN : –EC Number: 214-787-5MDL Number : MFCD00001781Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29269095Boc-NH-PEG8-CH2CH2NH2…
Tinuously exposed to NAADP-AM compared using the manage cells (manage, 0.56 0.08 sparks/100 m/s (n 71 cells), and NAADP, two.18 0.24 sparks/100 m/s (n 58 cells); p 0.001). On the…
Ults had been considered as statistically substantial in the event the p worth was 0.05.ReSulTSA total of 50 cases of infiltrating breast carcinomas on the triple adverse phenotype have been…
Product Name : 2-Amino-5-trifluoromethylpyridineSynonym : CAS: 74784-70-6Formula: C6H5F3N2Molecular Weight : 162.11Alternative CAS RN : –EC Number: –MDL Number : MFCD00042164Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2241720-34-1…
Product Name : 2-Methylhippuric acidSynonym : CAS: 42013-20-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : IodoformSynonym : TriiodomethaneCAS: 75-47-8Formula: CHI3Molecular Weight : 393.73Alternative CAS RN : –EC Number: 200-874-5MDL Number : MFCD00001069Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 290339905-Amino-3-methylindazole…
Product Name : 2-AminothiazoleSynonym : CAS: 96-50-4Formula: C3H4N2SMolecular Weight : 100.14Alternative CAS RN : –EC Number: 202-511-6MDL Number : MFCD00005325Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293410001190861-74-5…
Product Name : Benzildioxime (Diphenylglyoxime)Synonym : CAS: 23873-81-6Formula: C14H12N2O2Molecular Weight : 240.26Alternative CAS RN : –EC Number: 245-921-0MDL Number : MFCD00002113Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Bromonicotinic acid ethyl esterSynonym : CAS: 20986-40-7Formula: C8H8BrNO2Molecular Weight : 230.07Alternative CAS RN : –EC Number: –MDL Number : MFCD00040366Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Biomedcentral/1471-2164/14/Page 19 ofhybridisation (“glsFound” equal to 1) in less than 50 with the experiments and a imply fluorescence under 10 have been observed. Working with this approach, 753 probes had…
Rominent improvement of cognitive impairment and cognitive fluctuations, variably complicated by depression, anxiety, in addition to a propensity for medicationinduced hallucinations4. GBA mutations have also been implicated in dementia with…
Product Name : 1,3,4,6-Tetra-O-acetyl-2-amino-2-deoxy-N-(4-methoxybenzylidene)-β-D-galactopyranoseSynonym : CAS: 34948-61-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –(R)-JQ-1…
Product Name : 8-Hydroxyquinoline citrateSynonym : 8-Hydroxyquinolinium citrate; Citroxin; Quinolinol, citrate (1:1) (salt)CAS: 134-30-5Formula: C9H7NO · C6H8O7Molecular Weight : 337.29Alternative CAS RN : –EC Number: 205-136-6MDL Number : MFCD00054320Storage Temperature…
Product Name : ITSA-1Synonym : 1-(2,4-Dichlorobenzoyl)-1H-benzotriazole; Inhibitor-1 of Trichostatin A; N-(1H-Benzotriazol-1-yl)-2,4-dichlorobenzamideCAS: 200626-61-5Formula: C13H7Cl2N3OMolecular Weight : 292.12Alternative CAS RN : –EC Number: –MDL Number : MFCD00195103Storage Temperature : +4°CShipping Temperature :…
Product Name : 4-Bromo-2-fluoroanilineSynonym : CAS: 367-24-8Formula: C6H5BrFNMolecular Weight : 190.01Alternative CAS RN : –EC Number: 206-685-4MDL Number : MFCD00010221Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Ethyl…
Product Name : Thrombin Receptor Activator Peptide 6Synonym : TRAP-6CAS: 141136-83-6Formula: C34H56N10O9Molecular Weight : 748.90Alternative CAS RN : –EC Number: –MDL Number : MFCD00238172Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : Bis(trimethylsilyl)trifluoroacetamideSynonym : CAS: 25561-30-2Formula: C8H18F3NOSi2Molecular Weight : 257.40Alternative CAS RN : –EC Number: 247-103-9MDL Number : MFCD00008269Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 293190004-Methylbenzene-1,3-diol…
D-type nuclease domain.Gene targeting by GFP-ZFN2 inter-domain linker variants on target web pages with unique spacer lengths Since our in vitro research demonstrated that an inter-domain linker variant ZFN had…
An M1-human aminopeptidases, PfA-M1, and E. coli PepN have been compared, it was apparent that certainly one of the S1 cylinder residues (corresponding to Val-459 in PfA-M1) varies much more…
Product Name : ValeraldehydeSynonym : PentanalCAS: 110-62-3Formula: C5H10OMolecular Weight : 86.13Alternative CAS RN : –EC Number: 203-784-4MDL Number : MFCD00007026Storage Temperature : +20°CShipping Temperature : Refrigerated (+4°C)Harmonised Tariff Code :…
Product Name : 1-Adamantaneacetic acidSynonym : CAS: 4942-47-6Formula: C12H18O2Molecular Weight : 194.28Alternative CAS RN : –EC Number: 225-585-1MDL Number : MFCD00074728Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Benzoyl peroxideSynonym : CAS: 94-36-0Formula: C14H10O4Molecular Weight : 242.23Alternative CAS RN : –EC Number: 202-327-6MDL Number : MFCD00003071Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Sodium 2,3-dimercaptopropanesulfonate monohydrateSynonym : 2,3-Dimercaptopropanesulfonic acid sodium salt monohydrate; DMPS; Unithiolum monohydrate; Unitiol monohydrateCAS: 207233-91-8Formula: C3H7NaO3S3 · H2OMolecular Weight : 228.29Alternative CAS RN : 4076-02-2 (anhydr.)EC Number:…
Product Name : 3-Nitrophenyl b-D-glucopyranosideSynonym : CAS: 20838-44-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 7-FluorooxindoleSynonym : CAS: 71294-03-6Formula: C8H6FNOMolecular Weight : 151.14Alternative CAS RN : –EC Number: –MDL Number : MFCD02179608Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
P. xylostella.Supporting InformationTable S1 Genes related to toxicity response by DGE.(DOC)Table S2 Identification of hemolymph proteins by MALDITOF/TOF-MS/MS. (DOC)Quantitative Real-time PCR (qRT-PCR) ValidationTo confirm the digital expression profiling benefits, we…
S in parentheses refer towards the highest resolution bin. Data collection Synchrotron station Wavelength (? Space group Cell dimensions Resolution range (? Observations Exceptional reflections Completeness ( ) Rmergea I/…
Product Name : AscomycinSynonym : Immunomycin; FK-520CAS: 104987-12-4Formula: C43H69NO12Molecular Weight : 792.01Alternative CAS RN : 11011-38-4EC Number: –MDL Number : MFCD06198665Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff Code…
Product Name : 1,4-Diacetoxy-2-butyneSynonym : CAS: 1573-17-7Formula: C7H10O4Molecular Weight : 170.16Alternative CAS RN : –EC Number: 216-394-4MDL Number : MFCD00014982Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –5-Nitro-3-pyridinol…
Product Name : 5-Acetyl-2-thiopheneboronic acidSynonym : CAS: 206551-43-1Formula: C6H7BO3SMolecular Weight : 170.00Alternative CAS RN : –EC Number: –MDL Number : MFCD01075681Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : TetraethoxysilaneSynonym : Tetraethyl orthosilicate; Ethyl silicate; Silicic acid tetraethyl ester; Silicon ethoxide; TEOS; Tetraethyl silicateCAS: 78-10-4Formula: C8H20O4SiMolecular Weight : 208.33Alternative CAS RN : –EC Number: 201-083-8MDL Number…
Product Name : Decyltrimethylammonium bromideSynonym : CAS: 2082-84-0Formula: C13H30BrNMolecular Weight : 280.30Alternative CAS RN : –EC Number: 218-219-7MDL Number : MFCD00041973Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 5-Aminopyridine-2-carboxylic acid (5-Amino-2-picolinic acid)Synonym : CAS: 24242-20-4Formula: C6H6N2O2Molecular Weight : 138.13Alternative CAS RN : –EC Number: –MDL Number : MFCD02684600Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff…
Oughly before hematopoietic cells have been added for the culture. Hematopoietic cells had been collected in the termination with the experiment by collecting both the supernatant and the monolayer to…
Anthin in chicken egg yolk are 292 ?117 /yolk and 213 ?85 /yolk (typical weight of yolk is about 17?9 g), respectively and are most likely dependent on the variety…
Product Name : 4-BromoquinolineSynonym : CAS: 3964-04-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : 5-Chloro-2-fluoropyridineSynonym : CAS: 1480-65-5Formula: C5H3ClFNMolecular Weight : 131.54Alternative CAS RN : –EC Number: –MDL Number : MFCD04112513Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –132182-92-4…
Product Name : 5-Amino-2-fluorobenzonitrileSynonym : CAS: 53312-81-5Formula: C7H5FN2Molecular Weight : 136.13Alternative CAS RN : –EC Number: –MDL Number : MFCD00277872Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –857026-04-1…
Product Name : Diethyl 2-(2-cyanoethyl)malonateSynonym : CAS: 17216-62-5Formula: C10H15NO4Molecular Weight : 213.23Alternative CAS RN : –EC Number: 241-260-7MDL Number : MFCD00001966Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 6-AminoquinolineSynonym : CAS: 580-15-4Formula: C9H8N2Molecular Weight : 144.18Alternative CAS RN : –EC Number: 209-453-0MDL Number : MFCD00006803Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29334990(4,5-Dimethoxy-2-nitrophenyl)methanol…
Product Name : 1-D-3-Deoxy-myo-inositolSynonym : CAS: 488-76-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –528878-44-6…
Become extensively applicable in that use of hyperpolarized 13C technologies to monitor metabolism could substantially influence the diagnosis, staging, and measurement of response to therapy of disease (two). Multiple injection…
2010). The signaling pathways that happen to be linked to the immune potentiating actions of NE on HVECs are likely to be complicated and remain to become totally determined. As…
Product Name : Glycochenodeoxycholic acid sodium saltSynonym : 3α,7α-Dihydroxy-5β-cholanoic acid N-(carboxymethyl)amide sodium salt; N-(3α,7α-Dihydroxy-24-oxocholan-24-yl)glycine sodium salt; Sodium glycochenodeoxycholateCAS: 16564-43-5Formula: C26H42NNaO5Molecular Weight : 471.61Alternative CAS RN : –EC Number: –MDL Number…
Product Name : 4-tert-Butoxycarboxyphenylboronic acidSynonym : CAS: 380430-70-6Formula: C11H15BO5Molecular Weight : 238.05Alternative CAS RN : –EC Number: –MDL Number : MFCD03095144Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-MethylbenzoxazoleSynonym : CAS: 10531-78-9Formula: C8H7NOMolecular Weight : 133.15Alternative CAS RN : –EC Number: –MDL Number : MFCD00216938Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Methyl…
Product Name : Hydroxyzine dihydrochloride, USP gradeSynonym : 2--1-piperazinyl]ethoxy]ethanol dihydrochloride; AtaraxCAS: 2192-20-3Formula: C21H27ClN2O2 · 2HClMolecular Weight : 447.83Alternative CAS RN : 68-88-2 (free base)EC Number: 218-586-3MDL Number : MFCD00058200Storage Temperature…
Product Name : Ferrioxamine ESynonym : 1,12,23-Trihydroxy-1,6,12,17,23,28-hexaazacyclotritriacontane-2,5,13,16,24,27-hexone Iron(III) complexCAS: 20008-20-2Formula: C27H45FeN6O9Molecular Weight : 653.53Alternative CAS RN : –EC Number: –MDL Number : MFCD07785179Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 2-Chloro-5-nitro-6-picoline (2-Chloro-6-methyl-5-nitropyridine)Synonym : CAS: 22280-60-0Formula: C6H5ClN2O2Molecular Weight : 172.57Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Ion in cell varieties pertinent for CFRD Gene variants in four loci (TCF7L2, CDKAL1, CDKN2A/B, and IGF2BP2) associate with both sort 2 diabetes and CFRD. Loci that contribute to each…
NES DEVELOPMENTLiu et al.of the miR-138 mimics markedly elevated the level of miR-138 in adult DRGs (Fig. 3B). Functionally, sensory axons of miR-138/EGFP-overexpressing neurons displayed drastically impaired axon regeneration in…
Product Name : Estradiol valerateSynonym : 1,3,5(10)-Estratriene-3,17β-diol 17-pentanoteCAS: 979-32-8Formula: C23H32O3Molecular Weight : 356.50Alternative CAS RN : –EC Number: 213-559-2MDL Number : MFCD00056541Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 3-MethoxypyridineSynonym : CAS: 7295-76-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1427158-38-0…
Product Name : BenzilSynonym : Dibenzoyl; DiphenylethanedioneCAS: 134-81-6Formula: C14H10O2Molecular Weight : 210.23Alternative CAS RN : –EC Number: 205-157-0MDL Number : MFCD00003080Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : (S)-Amino-(tetrahydropyran-4-yl)acetic acidSynonym : CAS: 811842-25-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methylphenyl 2,3-di-O-benzyl-1-thio-α-D-mannopyranosideSynonym : CAS: 922523-13-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : AtrasentanSynonym : CAS: 173937-91-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Amino-4-bromo-6-fluorobenzaldehyde…
Product Name : 2-Hydroxyethyl methacrylateSynonym : CAS: 868-77-9Formula: C6H10O3Molecular Weight : 130.14Alternative CAS RN : –EC Number: 212-782-2MDL Number : MFCD00002863Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-Chloro-6-fluorotolueneSynonym : CAS: 443-83-4Formula: C7H6ClFMolecular Weight : 144.58Alternative CAS RN : –EC Number: 207-141-9MDL Number : MFCD00000570Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290399903,5-Dichloropyridopyrazine…
Product Name : 3-Ethyl-3-(ethylaminoethyl)-1-hydroxy-2-oxo-1-triazeneSynonym : NOC-12CAS: 146724-89-2Formula: C6H16N4O2Molecular Weight : 176.22Alternative CAS RN : –EC Number: –MDL Number : MFCD00674898Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 4-(2-Aminoethyl)morpholineSynonym : CAS: 2038-03-1Formula: C6H14N2OMolecular Weight : 130.19Alternative CAS RN : –EC Number: 218-011-6MDL Number : MFCD00006182Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293499902422999-74-2…
Product Name : 2”,5”-DifluoroacetophenoneSynonym : CAS: 1979-36-8Formula: C8H6F2OMolecular Weight : 156.13Alternative CAS RN : –EC Number: 217-837-4MDL Number : MFCD00009898Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29147000Price…
Product Name : 7-Bromoheptan-1-olSynonym : CAS: 10160-24-4Formula: C7H15BrOMolecular Weight : 195.10Alternative CAS RN : –EC Number: –MDL Number : MFCD00041708Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –23405-32-5…
Product Name : 3-Carbethoxy-2-piperidoneSynonym : CAS: 3731-16-6Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999Formula…
Product Name : R-(-)-1,2-PropanediolSynonym : CAS: 4254-14-2Formula: C3H8O2Molecular Weight : 76.10Alternative CAS RN : –EC Number: –MDL Number : MFCD00066248Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 29053200004-Azidobutylamine…
Product Name : 4-Methoxyphenyl b-D-galactopyranosideSynonym : CAS: 3150-20-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Fluoro-2-methylphenylboronic acidSynonym : CAS: 163517-62-2Formula: C7H8BFO2Molecular Weight : 153.95Alternative CAS RN : –EC Number: –MDL Number : MFCD03095047Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : IngenolSynonym : (1aR,2S,5R,5aR,6S,8aS,9R,10aR)-1a,2,5,5a,6,9,10,10a-Octahydro-5,5a,6-trihydroxy-4-(hydroxymethyl)-1,1,7,9-tetramethyl-1H-2,8a-methanocyclopentacyclopropacyclodecen-11-oneCAS: 30220-46-3Formula: C20H28O5Molecular Weight : 348.43Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Buy143062-85-5…
Product Name : HeneicosanolSynonym : CAS: 15594-90-8Formula: CH3(CH2)20OHMolecular Weight : 312.57Alternative CAS RN : –EC Number: 239-673-2MDL Number : MFCD00062834Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –3-Amino-2-azepanone…
Product Name : 1-AcetonaphthoneSynonym : CAS: 941-98-0Formula: C12H10OMolecular Weight : 170.21Alternative CAS RN : –EC Number: 213-384-1MDL Number : MFCD00004013Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 291439005,5′-Oxybis(isobenzofuran-1,3-dione)…
Product Name : IsokaempferideSynonym : CAS: 1592-70-7Formula: C16H12O6Molecular Weight : 300.26Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –Perfluorohexyloctane…
Product Name : Copper(II) sulfate, anhydrous, Ph. 1539-42-0 web 1018446-95-1 supplier Eur. gradeSynonym : Cupric sulfate anhydrous; Copper (II) sulphate; Copper sulphate; Copper sulfate; Copper sulfate anhydrousCAS: 7758-98-7Formula: CuSO4Molecular Weight…
Product Name : 3-PhenoxyphenolSynonym : CAS: 713-68-8Formula: C12H10O2Molecular Weight : 186.21Alternative CAS RN : –EC Number: 211-930-3MDL Number : MFCD00003543Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Aminothiazole-4-carbaldehyde…
Product Name : 2”-AminoacetophenoneSynonym : 2-AcetylanilineCAS: 551-93-9Formula: C8H9NOMolecular Weight : 135.17Alternative CAS RN : –EC Number: 209-002-8MDL Number : MFCD00007717Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 292239002241128-09-4…
Product Name : (3-Methoxyphenyl)acetonitrileSynonym : CAS: 19924-43-7Formula: C9H9NOMolecular Weight : 147.18Alternative CAS RN : –EC Number: 243-428-5MDL Number : MFCD00001910Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29269095849805-25-0…
Product Name : ChitinSynonym : Poly-(1→4)-β-N-acetyl-D-glucosamine; Poly-(b1-4)-N-acetyl glucosamine/Poly-(a1-4)-N-acetyl glucosamine; (1,4)-N-acetyl-D-glucos-2-amineCAS: 1398-61-4Formula: nMolecular Weight : nAlternative CAS RN : –EC Number: 215-744-3MDL Number : MFCD00466914Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : 1-Phenylsulfonylindole-3-boronic acidSynonym : CAS: 129271-98-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,3-Diphenyl-1,3-propanedioneSynonym : DibenzoylmethaneCAS: 120-46-7Formula: C15H12O2Molecular Weight : 224.26Alternative CAS RN : –EC Number: 204-398-9MDL Number : MFCD00003085Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29143900212651-52-0…
Product Name : 2,2,6,6-Tetramethyl-4-piperidoneSynonym : CAS: 826-36-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29333999Buy2049109-24-0…
Product Name : Tetra-n-butylammonium trifluoromethanesulfonateSynonym : CAS: 35895-70-6Formula: 4NCF3SO3Molecular Weight : 391.54Alternative CAS RN : –EC Number: 252-783-5MDL Number : MFCD00042585Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : Benzylamine-Trifluoroborane complex (1:1)Synonym : CAS: 696-99-1Formula: C7H9BF3NMolecular Weight : 174.96Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 2,4,6-TribromoanisoleSynonym : CAS: 607-99-8Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290930384-Fluoropicolinaldehyde…
Product Name : 3,5-Pyridinedicarboxylic acidSynonym : CAS: 499-81-0Formula: C7H5NO4Molecular Weight : 167.12Alternative CAS RN : –EC Number: 207-893-8MDL Number : MFCD00006393Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Tetraethyl orthocarbonateSynonym : CAS: 78-09-1Formula: C9H20O4Molecular Weight : 192.26Alternative CAS RN : –EC Number: 201-082-2MDL Number : MFCD00009221Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Hydroxycinnamic acidSynonym : CAS: 588-30-7Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Bromo-2-fluorobenzotrifluorideSynonym : CAS: 144584-67-8Formula: C7H3BrF4Molecular Weight : 243.00Alternative CAS RN : –EC Number: –MDL Number : MFCD00070812Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –1-Bromo-4-(trifluoromethyl)benzene…
Product Name : DL-Malic acidSynonym : (±)-2-Hydroxysuccinic acid; DL-Hydroxybutanedioic acid; DL-Apple acidCAS: 6915-15-7Formula: C4H6O5Molecular Weight : 134.09Alternative CAS RN : 617-48-1EC Number: 230-022-8MDL Number : MFCD00064212Storage Temperature : +20°CShipping Temperature…
Product Name : Methyl trans-cinnamateSynonym : trans-Cinnamic acid methyl esterCAS: 1754-62-7Formula: C10H10O2Molecular Weight : 162.19Alternative CAS RN : –EC Number: –MDL Number : MFCD00008458Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : N-Hexanoyl-D-sphingosineSynonym : C6 ceramide; Caproyl ceramide; N-Caproyl-D-sphingosineCAS: 124753-97-5Formula: C24H47NO3Molecular Weight : 397.63Alternative CAS RN : –EC Number: –MDL Number : MFCD00870174Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : Indomethacin acyl-b-D-glucuronideSynonym : CAS: 75523-11-4Formula: C25H24ClNO10Molecular Weight : 533.91Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : Wet iceHarmonised Tariff Code…
Product Name : 2-Bromo-6-chloropyridineSynonym : CAS: 5140-72-7Formula: C5H3BrClNMolecular Weight : 192.44Alternative CAS RN : –EC Number: 225-904-4MDL Number : MFCD00181262Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 3-Chloro-2,6-difluorobenzoic acidSynonym : CAS: 225104-76-7Formula: C7H3ClF2O2Molecular Weight : 192.55Alternative CAS RN : –EC Number: –MDL Number : MFCD01631322Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1,5-IsoquinolinediolSynonym : 1,5-Dihydroxyisoquinoline; 5-Hydroxy-1(2H)-isoquinolinone; DiQCAS: 5154-02-9Formula: C9H7NO2Molecular Weight : 161.16Alternative CAS RN : –EC Number: –MDL Number : MFCD00006900Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 3-NitrophenolSynonym : CAS: 554-84-7Formula: C6H5NO3Molecular Weight : 139.11Alternative CAS RN : –EC Number: 209-073-5MDL Number : MFCD00007240Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 290899001-(2-Aminoethyl)piperidin-4-ol…
Product Name : DFBSynonym : 3,3′-DifluorobenzaldazineCAS: 15332-10-2Formula: C14H10F2N2Molecular Weight : 244.24Alternative CAS RN : –EC Number: –MDL Number : MFCD03653615Storage Temperature : +4°CShipping Temperature : –Harmonised Tariff Code : –Methyl…
Product Name : NO-711 hydrochlorideSynonym : 1-oxy]ethyl]-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid hydrochloride hydrochlorideCAS: 145645-62-1Formula: C21H22N2O3 · HClMolecular Weight : 386.87Alternative CAS RN : –EC Number: –MDL Number : MFCD00153853Storage Temperature : –Shipping Temperature…
Product Name : MethacrylamideSynonym : CAS: 79-39-0Formula: C4H7NOMolecular Weight : 85.11Alternative CAS RN : –EC Number: 201-202-3MDL Number : MFCD00008018Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292419002-Bromo-5-cyclopropylpyrimidine…
Product Name : 3-Chloro-4-fluorobenzaldehydeSynonym : CAS: 34328-61-5Formula: C7H4ClFOMolecular Weight : 158.56Alternative CAS RN : –EC Number: –MDL Number : MFCD00011735Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –737007-45-3…
Product Name : Heptane, technical gradeSynonym : CAS: 142-82-5Formula: C7H16Molecular Weight : 100.21Alternative CAS RN : –EC Number: 205-563-8MDL Number : MFCD00009544Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : 2,3-Diketo-L-gulonic acidSynonym : L-threo-2,3-Hexodiulosonic acidCAS: 3445-22-5Formula: C6H8O7Molecular Weight : 192.12Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code…
Product Name : 3-TrifluoromethylphenylhydrazineSynonym : CAS: 368-78-5Formula: C7H7F3N2Molecular Weight : 176.14Alternative CAS RN : –EC Number: 206-713-5MDL Number : MFCD00025093Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Price…
Product Name : Muscimol hydrobromideSynonym : 5-Aminomethyl-3-hydroxyisoxazole hydrobromideCAS: 18174-72-6Formula: C4H6N2O2 · HBrMolecular Weight : 195.01Alternative CAS RN : –EC Number: –MDL Number : MFCD00055184Storage Temperature : +4°CShipping Temperature : –Harmonised…
Product Name : (R)-3-Hydroxybutyric acidSynonym : CAS: 625-72-9Formula: C4H8O3Molecular Weight : 104.10Alternative CAS RN : –EC Number: 210-909-6MDL Number : MFCD00066257Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2,6-Naphthalenedicarboxylic acidSynonym : CAS: 1141-38-4Formula: C12H8O4Molecular Weight : 216.19Alternative CAS RN : –EC Number: 214-527-0MDL Number : MFCD00004105Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 5-Bromopyrazine-2,3-diamineSynonym : CAS: 89123-58-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2126818-91-3…
Product Name : RS-127445 hydrochlorideSynonym : 2-Amino-4-(4-fluoronaphth-1-yl)-6-isopropylpyrimidine hydrochlorideCAS: 199864-86-3Formula: C17H16FN3 · HClMolecular Weight : 317.79Alternative CAS RN : –EC Number: –MDL Number : MFCD11112196Storage Temperature : +4°CShipping Temperature : –Harmonised…
Product Name : Delapril hydrochlorideSynonym : CAS: 83435-67-0Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-Benzylthiopropionic acidSynonym : CAS: 2899-66-3Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methyl-3-nitropyridineSynonym : CAS: 5832-44-0Formula: C6H6N2O2Molecular Weight : 138.13Alternative CAS RN : –EC Number: –MDL Number : MFCD00051829Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –2-Chloropyrimidine-4,5-diamine…
Product Name : ButylamineSynonym : CAS: 109-73-9Formula: C4H11NMolecular Weight : 73.14Alternative CAS RN : –EC Number: 203-699-2MDL Number : MFCD00011690Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code : 292119992-Cyclopentenone…
Product Name : 2-Acetamido-2-deoxy-β-D-glucopyranosyl azideSynonym : CAS: 29847-23-2Formula: Molecular Weight : 246.22Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code :…
Product Name : 2-Chloro-5-trifluoromethylpyridineSynonym : CAS: 52334-81-3Formula: C6H3ClF3NMolecular Weight : 181.55Alternative CAS RN : –EC Number: 257-856-5MDL Number : MFCD00042225Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 293339996-Bromobenzoisothiazole…
Product Name : Carbethoxymethylene triphenylphosphoraneSynonym : CAS: 1099-45-2Formula: CH3CH2O2CCH=P(C6H5)3Molecular Weight : 348.38Alternative CAS RN : –EC Number: 214-151-7MDL Number : MFCD00009183Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 4-Isopropyloxyphenylboronic acidSynonym : CAS: 153624-46-5Formula: C9H13BO3Molecular Weight : 180.01Alternative CAS RN : –EC Number: –MDL Number : MFCD03427051Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 4-Methoxycarbonyl-2-nitrophenylboronic acidSynonym : CAS: 85107-55-7Formula: C8H8BNO6Molecular Weight : 224.96Alternative CAS RN : –EC Number: –MDL Number : MFCD01632202Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 3-BromoindoleSynonym : CAS: 1484-27-1Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –Formula…
Product Name : 2-Chloro-3-fluoropyridineSynonym : CAS: 17282-04-1Formula: C5H3ClFNMolecular Weight : 131.54Alternative CAS RN : –EC Number: –MDL Number : MFCD03095302Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –P(t-Bu)3…
Product Name : (S)-(+)-2-ButanolSynonym : CAS: 4221-99-2Formula: C4H10OMolecular Weight : 74.12Alternative CAS RN : –EC Number: 224-168-1MDL Number : MFCD00064281Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29051490BuyChlorotriethoxysilane…
Product Name : 4-Chloromandelic acidSynonym : CAS: 492-86-4Formula: C8H7ClO3Molecular Weight : 186.60Alternative CAS RN : –EC Number: 207-764-6MDL Number : MFCD00042724Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : 1-KestoseSynonym : β-D-Fruf-(2→1)-β-D-Fruf-(2→1)-α-D-GlupCAS: 470-69-9Formula: C18H32O16Molecular Weight : 504.44Alternative CAS RN : –EC Number: –MDL Number : MFCD00142647Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code : 2940000080196862-45-0…
Product Name : Sulfobromophthalein disodium salt hydrateSynonym : BSP; Bromsulfalein sodium disodium salt hydrate; BromosulfaleinCAS: 123359-42-2Formula: C20H8Br4Na2O10S2 · xH2OMolecular Weight : 838.00 (anhydrous)Alternative CAS RN : 71-67-0EC Number: 200-761-0MDL Number…
Product Name : Methyl stearateSynonym : Methyl octadecanoate; Stearic acid methyl esterCAS: 112-61-8Formula: C19H38O2Molecular Weight : 298.51Alternative CAS RN : –EC Number: 203-990-4MDL Number : MFCD00009005Storage Temperature : +20°CShipping Temperature…
Product Name : Tetrabutylammonium bromideSynonym : TBAB; Tetrabutyl ammonium bromide; Tetra-n-butylammonium bromide; TBABrCAS: 1643-19-2Formula: C16H36BrNMolecular Weight : 322.38Alternative CAS RN : –EC Number: 216-699-2MDL Number : MFCD00011633Storage Temperature : +20°CShipping…
Product Name : 2-Pyridylacetic acid hydrochlorideSynonym : CAS: 16179-97-8Formula: C7H7NO2HClMolecular Weight : 173.60Alternative CAS RN : –EC Number: 240-316-8MDL Number : MFCD00012812Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 3-Bromobenzyl alcoholSynonym : CAS: 15852-73-0Formula: C7H7BrOMolecular Weight : 187.04Alternative CAS RN : –EC Number: 239-975-4MDL Number : MFCD00004629Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Phenol, 99%Synonym : HydroxybenzeneCAS: 108-95-2Formula: C6H6OMolecular Weight : 94.11Alternative CAS RN : –EC Number: 203-632-7MDL Number : MFCD00002143Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-PyrrolidinoneSynonym : 2-Pyrrolidone; Butyrolactam; 2-Azacyclopentanone; γ-Butyrolactam; 2-KetopyrrolidineCAS: 616-45-5Formula: C4H7NOMolecular Weight : 85.11Alternative CAS RN : –EC Number: 210-483-1MDL Number : MFCD00005270Storage Temperature : +20°CShipping Temperature : AmbientHarmonised…
Product Name : Anisyl acetateSynonym : 4-Methoxybenzyl acetate; Acetic acid anisyl esterCAS: 104-21-2Formula: C10H12O3Molecular Weight : 180.20Alternative CAS RN : –EC Number: 203-185-8MDL Number : MFCD00038509Storage Temperature : +20°CShipping Temperature…
Product Name : YS-49 monohydrateSynonym : 1,2,3,4-Tetrahydro-1-(1-naphthalenylmethyl)-6,7-Isoquinolinediol hydrobromide monohydrateCAS: 132836-42-1Formula: C20H19NO2 · HBr · H2OMolecular Weight : 404.30Alternative CAS RN : –EC Number: –MDL Number : MFCD16875442Storage Temperature : +4°CShipping…
Product Name : trans-3-Hydroxycinnamic acidSynonym : m-Coumaric acidCAS: 14755-02-3Formula: C9H8O3Molecular Weight : 164.16Alternative CAS RN : –EC Number: 209-615-0MDL Number : MFCD00004390Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code…
Product Name : 1,4-DibromobutaneSynonym : CAS: 110-52-1Formula: C4H8Br2Molecular Weight : 215.93Alternative CAS RN : –EC Number: 203-775-5MDL Number : MFCD00000261Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 290339195-(Thiazol-5-yl)nicotinic…
Product Name : 2-Phenylbutyric acidSynonym : 2-Ethyl-2-phenylacetic acid; 2-Phenylbutanoic acid; α-Ethylphenylacetic acid; (±)-2-Phenylbutyric acidCAS: 90-27-7Formula: C10H12O2Molecular Weight : 164.20Alternative CAS RN : –EC Number: 201-982-5MDL Number : MFCD00002667Storage Temperature :…
Product Name : 4-HydroxyphenylacetamideSynonym : CAS: 17194-82-0Formula: C8H9NO2Molecular Weight : 151.17Alternative CAS RN : –EC Number: 241-235-0MDL Number : MFCD00017145Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29242998Azetidin-2-one…
Product Name : 4-Nitrophenyl β-D-lactopyranosideSynonym : 4-Nitrophenyl b-D-lactopyranosideCAS: 4419-94-7Formula: C18H25NO13Molecular Weight : 463.39Alternative CAS RN : –EC Number: –MDL Number : MFCD00069843Storage Temperature : -20°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : Pyridine-2-carboxaldehydeSynonym : 2-Pyridinecarboxaldehyde; PicolinaldehydeCAS: 1121-60-4Formula: C6H5NOMolecular Weight : 107.11Alternative CAS RN : –EC Number: 214-333-6MDL Number : MFCD00006290Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : (R)-(+)-Benzyl-1,3-thiazolidine-2-thioneSynonym : CAS: 110199-17-2Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : –942518-20-9…
Product Name : 4-Benzyloxy-3-fluorophenylboronic acidSynonym : CAS: 133057-83-7Formula: C13H12BFO3Molecular Weight : 246.04Alternative CAS RN : –EC Number: –MDL Number : MFCD00994627Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code :…
Product Name : Ethyl succinyl chlorideSynonym : CAS: 14794-31-1Formula: ClOCCH2CH2CO2CH2CH3Molecular Weight : 164.59Alternative CAS RN : –EC Number: 238-855-9MDL Number : MFCD00000751Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff Code…
Product Name : KN-62Synonym : (S)-5-Isoquinolinesulfonic acid 4--3-oxo-3-(4-phenyl-1-piperazinyl)propyl]phenyl ester; 1--4-phenylpiperazineCAS: 127191-97-3Formula: C38H35N5O6S2Molecular Weight : 721.84Alternative CAS RN : –EC Number: –MDL Number : MFCD00083180Storage Temperature : -20°CShipping Temperature : –Harmonised…
Product Name : 4-Methoxy-3-nitrobenzotrifluorideSynonym : CAS: 394-25-2Formula: C8H6F3NO3Molecular Weight : 221.14Alternative CAS RN : –EC Number: 206-891-4MDL Number : MFCD00007099Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29093090867065-85-8…
Product Name : FK-506 monohydrateSynonym : Tacrolimus; FujimycinCAS: 109581-93-3Formula: C44H69NO12 · H2OMolecular Weight : 822.03Alternative CAS RN : 104987-11-3EC Number: –MDL Number : MFCD11045918Storage Temperature : -20°CShipping Temperature : AmbientHarmonised…
Product Name : 5-BromopyrimidineSynonym : CAS: 4595-59-9Formula: C4H3BrN2Molecular Weight : 158.99Alternative CAS RN : –EC Number: 224-992-1MDL Number : MFCD00006117Storage Temperature : –Shipping Temperature : –Harmonised Tariff Code : 29335995Acid-PEG2-C2-Boc…
Product Name : 4-(Methylamino)cyclohexanone 2,2-dimethyltrimethylene ketal hydrochlorideSynonym : CAS: 158747-10-5Formula: Molecular Weight : Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : –Shipping Temperature : –Harmonised Tariff…
Product Name : Bedaquiline fumarateSynonym : CAS: 845533-86-0Formula: C32H31BrN2O2.C4H4O4Molecular Weight : 671.58Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : +20°CShipping Temperature : AmbientHarmonised Tariff Code :…
Product Name : 2-Chloro-4-nitrophenyl-α-D-glucopyranosideSynonym : CAS: 119047-14-2Formula: Molecular Weight : 335.69Alternative CAS RN : –EC Number: –MDL Number : –Storage Temperature : -20°CShipping Temperature : –Harmonised Tariff Code : –1,2,3,5,6,7-Hexahydro-s-indacene…
Product Name : 5-Bromo-4-chloro-3-indolyl acetateSynonym : 5-Bromo-4-chloroindoxyl acetate; 3-Acetoxy-4-chloro-5-bromoindoleCAS: 3252-36-6Formula: C10H7BrClNO2Molecular Weight : 288.53Alternative CAS RN : –EC Number: –MDL Number : MFCD00037932Storage Temperature : +4°CShipping Temperature : AmbientHarmonised Tariff…
Product Name : 1,10-Phenanthroline hydrochloride monohydrateSynonym : o-Phenanthroline hydrochloride monohydrateCAS: 18851-33-7Formula: C12H8N2 · HCl · H2OMolecular Weight : 234.68Alternative CAS RN : 3829-86-5EC Number: 223-325-1MDL Number : MFCD00150061Storage Temperature :…
Istered for the duration of reconditioning). The day soon after the last reconditioning session, mice received an added test session (Reconditioning), followed by a long-term retention test (Retention) 21 d…
Dividual genes.Collakova et al. BMC Plant Biology 2013, 13:72 http://biomedcentral/1471-2229/13/Page 3 ofResultsPhotosynthesis and respirationThe vast majority of responsive genes associated with chloroplast function were down-regulated following the time point 2…
Effects of E/S therapy on LDL-P and HDL-P have not been previously reported working with NMR spectroscopy. Having said that, in many research, E/S decreased the cholesterol content material of…
D by PCR for Stra8 gene. The primers made use of to detect Stra8 are 5- GGGTTTGGGT ATAGTTTTTT ATG-3 (forward), and 5-TTATTAAAAA ACCCTACCAA AATAAC-3 (reverse). The PCR merchandise had been…
Ver disease can present differently and have one of a kind prognostic features compared with patients that have cirrhosis. Due to the fact individuals with no cirrhosis usually are not…
Rats (Sal-Cond: 1.6 0.three, Sal-Ext: 4.four 0.8, MPEP-Ext: 1.eight 0.2). A one-way ANOVA showed a considerable most important effect (F(2,33) six.34; p 0.005) and post hoc comparisons identified that the…
A values in Table four are obtained from its time evolution in Fig. S11. The electrostatic potential map is obtained from the typical structures of your cis-N-acetyl bound CDK complexes…
Stages of recovery (i.e. 30 min soon after exercising). In contrast, our findings indicate for the initial time that noradrenergic vasoconstriction does contribute towards the reduction in cutaneous blood flow…
Resentative imply fluorescence intensity (MFI) of intracellular pErk measured by flow cytometry in bone marrow 3?3Igi NA immature B cells stimulated for 5 min at 37 with anti-IgM F(ab)two or…
S described previously working with an RSV-PL4 expression vector in human embryonic kidney 293 cells, and purified on an HPC4 immunoaffinity column.six,21,22 All batches of rCAP37 were dialyzed in 0.01…
VOLUME 36, AUGUST 2013T2DM with lipodystrophy of limbs onset for T2DM was earlier in the individuals with PLL than within the controls by far more than a complete decade (28.9…
46a]BAABAABAABAABBABBAAAAAAABBABBA5 Mixture Therapy in Rheumatoid ArthritisBAABAABBABBABAABAABAABAA*Percentage of Annual Radiographic Progression Rate doi:ten.1371/journal.pone.0106408.tCombination Therapy in Rheumatoid ArthritisFigure 2. Mixture treatment versus single DMARD. The impact on all research is 20.33 SMD…
Neous and inflammation-driven tumor models,2 yet it might also limit the growth of early neoplastic lesions by stimulating cell senescence.three Additionally, the proinflammatory CXCR2 ligands CXCL2 and CXCL8 have been…
, a halide-sensitive fluorescent indicator applied to assess ligand-gated chloride channel function . Following transduction, cells were incubated at 37uC, 5 CO2 overnight and seeded onto a 96-well plate at…
AlCerS (anti sense) CCTTGTGAATTTCCGAAAGC, LacCerS (sense) TCATTGGAGGCCAAAAGACT, LacCerS (anti sense) TTCATGGCPLOS A single | plosone.orgGLTP Senses Glycosphingolipid ChangesFigure 1. GLTP expression, GlcCer, Galcer, LacCer, ceramide and sphingomyelin synthesis in HSF…
Essed during mitosis and meiosis. We subsequent analyzed steady-state mRNA levels of mca1 as a function of copper availability throughout mitosis and meiosis. Experiments working with cells proliferating in mitosis…
Ernal energy, the hydration power, along with the monolayer ir interaction. Mainly because the tails in the case of a monolayer are cost-free to associate with only the hydrophobic gaseous…
Respectively. HDL-C alter from baseline was located to be negatively correlated with baseline HDL-C. A pharmacologically independent LDL-C reduction was identified when evacetrapib was coadministered with statins. CPT Pharmacometrics Syst.…
, with water immersion HCX APO 20X with 1.00 NA lens and two mm functioning distance. 5. Immediately after the experiment, euthanize anesthetized mouse with cervical dislocation followed by exsanguination…
Projection neurons, five ms light pulses had been delivered to VTA to antidromically stimulate BNSTv projection neurons that innervated the location. Light pulses have been delivered in ten s intervals…
El of TNF of six.7?.3 ng/ml measured two h soon after TNF injection, which falls in the identical variety as that two h just after LPS challenge (3-10 ng/ ml).37,…
Rsal striatum (F(two,21) = 21.21; p \ 0.0001). Post hoc analyses revealed the significant improve of AEA within the hippocampus (p \ 0.001) after acute administration of IMI. Immediately after…
Regrown on glucose and subsequently shifted to oleate-containing media. Following 6 (C) and 12 (D) h of incubation, LDs are massively induced in the cytosol and are also present inside…
TS domain of Raf2 is significant for the maintenance of heterochromatin integrity and thus centromere function.centromeres but is dispensable for the production of siRNA, as previously proposed .Mutations within the…
O the culture medium at a final concentration of 1 (v/v). After fixation at space temperature for 10 minutes, L-glycine (final concentration, 0.125 mol/L) was added to terminate the cross-linking…
Physician primarily based on the patients’ tolerance and plasma ascorbic acid levels attained post infusion. As hemolysis has been reported in sufferers with glucose6-phosphate dehydrogenase (G6PD) deficiency when given high-dose…
Mpared to WT counterparts (Fig. 5B and C). In addition, expression of RANKL in Ercc1-/vertebrae was enhanced 4fold, whereas OPG expression was decreased by 70 in comparison to WT animals…
Ptotic viruses market Ag cross-presentation (Livingston-Rosanoff and Mocarski, in preparation), leading to a model that relates Ag load and CD8 T cell response (Fig. 3). The current success of rhesus…
Ed as a part of a functional complicated with NHE1 and CAII, referred to as the hypertrophic transport metabolon (HTM), whose activation has been proposed to induce cardiac hypertrophy .…
Enetration, primarily resulting from decreased absorption and lowered scattering from the light. Having said that, mainly because the energy of the photon absorbed by the sensitizer is proportional for the…
Resulting preparation; the mixture was named G2F and divided into 5-ml aliquots in glass vials beneath sterile circumstances.Tissue preparationsThe guinea pigs have been sacrificed by cervical dislocation along with the…
With Trp234 and Phe232 within the C1 domain, which prevents the access of ligands. Furthermore, hydrophobic amino acids within the Rac-GAP domain interact with residues within the C1 domain, as…
S. (2011). Function of plastid sigma things in larger plants: Regulation of gene expression or simply preservation of constitutive transcription? Plant Mol. Biol. 76: 235?49. Liu, J., Yang, H., Lu,…
) used to resolve structure: SHELXS97 (Sheldrick, 2008); program(s) applied to refine structure: SHELXL97 (Sheldrick, 2008); molecular graphics: SHELXTL (Sheldrick, 2008); software applied to prepare material for publication: SHELXL97 (Sheldrick,…
Linkage groups. Likewise, the fraction of distorted markers was equal within the maternal and paternal information set. If odd segregation ratios had been triggered by gene conversion, equal numbers of…
Ptors, e.g., Dectin-1, complement receptor (CR3), scavenger receptors (SR), lactosylceramide (LacCer), and toll-like receptors, e.g., TLR-2/6, and trigger responses in macrophages, neutrophils, monocytes, all-natural killer cells, and dendritic cells in…
Er 1 d of reperfusion in mild and moderate focal cerebral ischemia models. 1 study carried out by Du et al., has shown that EA pretreatment elicited neuroprotective effects by…
The BAK hydrophobic groove, we subsequent examined no matter whether Bid was capable to Co-IP BAKAzad and Storey Molecular Cancer 2013, 12:65 http://molecular-cancer/content/12/1/Page 4 ofFigure 2 Cytochrome c release and…
S. Evaluation of FITC annexin V-labeled apoptotic cells was carried out according towards the protocol presented by the manufacturer (Becton Dickinson, Franklin Lakes, NJ, USA). Cells had been seeded on…
Sed as negative and optimistic controls, respectively.Fluor 488-conjugated goat anti-rabbit IgG, and Alexa Fluor 555-conjugated goat anti-mouse IgG for one h. The chamber slides had been washed and mounted ahead…
PA Author ManuscriptBotelho et al.PageResultsOncostatin M stimulates iBALT formation and B cell accumulation and activation in the mouse lung We and others have previously highlighted the capability of IL-6 overexpression…
E biological impact of its crucial oil on pathogenic fungal isolated from HIV/ AIDS individuals are limited. The aim of this study is always to evaluate the inhibitory potential of…
Il biodiesel100.80.00 60.00 40.00 20.00 0.00 KOH NVOZYME 435 NaOH NaOCH3 A.n. lipaseCatalysts and enzymes made use of for transesterification Error bars: +/-1 SDFigure 2: Optimized palm oil biodiesel yield…
E alignment and phylogenetic analysis of your protein sequence also show its molecular relatedness to exopolysaccharide synthesis household proteins amongst other bacteria and homologous for the acetyl-CoA transferases of other…
. Neurosci. 2012; 15:998?006. 12. Li L, Bischofberger J, Jonas P. Differential gating and recruitment of P/Q-, N-, and R-type Ca2+ channels in hippocampal mossy fiber boutons. J. Neurosci. 2007;…
In pedigree OH Homozygosity mapping–To recognize the genetic etiology for the clinical phenotype in pedigree OH, DNA was extracted in the peripheral blood of three affected loved ones members (III:three,…
Ior part of nascent hindlimb bud (n=3, Fig. 2C, G). These benefits recommended that, despite a broad contribution ofDev Biol. Author manuscript; offered in PMC 2015 March 01.Akiyama et al.PageIsl1-lineages…
An amidolytic activity assay employing SpFXa (200M). The anticoagulant activities of APC derivatives were also evaluated in normal and protein Sdeficient plasma by an aPTT assay applying Start off four…
Ublineage. However, the NA genes from the isolated H5N9 viruses have been clustered with human-infecting H7N9 viruses. Notably, these previously reported H5N9 viruses were disseminated in a further branch with…
Protein kinase HOG1 Zinc transporter Zinc transporter Response to iron ion starvation Response to iron ion starvation Melanin biosynthesis Nitrogen metabolism Nitrogen metabolism Nitrogen metabolism Nitrogen metabolism Metallopeptidase, Fungal allergen…
Inhibiting antibod ies. J Exp Med. 1990;172:3792. 31. Bannister LH, Hopkins JM, Dluzewski AR, Margos G, Williams IT, Blackman MJ, et al. Plasmodium falciparum apical membrane antigen 1 (PfAMA1) is…
AnoDrop ND-1000 (Thermo Scientific). The synthesis of cDNA from RNA was performed using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor 1000 Reactions (Applied Biosystems) on a Biometra thermocycler.…
Uirement of a crucial gluconeogenic enzyme, pyruvate carboxykinase (PckA), for full virulence (227). M. tuberculosis will not flux lipid-derived carbon via the canonical Krebs pathway because it is incompatible with…
G a host-pathogen interaction. Tricarboxylic acid cycle (Krebs cycle)–As mentioned earlier, reductive evolution has strongly influenced central metabolism in Gram-positive bacteria, and also the Krebs cycle could be the most…
Cies reassortment of H13 subtype virus among Anseriforme sand Charadriiformes wild birds emphasizes the significance of strengthening avian influenza surveillance within this area. This study is beneficial to understand the…
Linding, the statistical analysis plan was amended from equivalence to non-inferiority. The power of the trial at this time was estimated to become around 86 plus a new non-inferiority bound…
Therapy.org vol. 22 no. 8, 1484493 aug.The American Society of Gene Cell TherapyCystic Fibrosis Sputum Barrier to AAV Gene Therapythe initially AAV serotype characterized plus the only a single tested…
Berg, M.; Bomke, S.; Karst, U.; Ravoo, B.J. Dynamic peptides as biomimetic carbohydrate receptors. Angew. Chem. Int. Ed. Engl. 2010, 49, 7340345. Ke, C.; Destecroix, H.; Crump, M.P.; Davis, A.P.…
E pull-down assays. MT and PG chosen AD sufferers for participation and supplied blood samples. MC, MAN, MT, PG, and JS designed and carried out the UBB+1 immunoblot assay for…
Ti-CD103. Both frequency of CD103+ CD8 T cells and MFI are presented (n=5). (E) Tumor volumes measured over time in B16 melanoma model treated with IC, anti-CD103, anti-LAP or combined…
Only some CD103+ CD8 T cells infiltrate the tumor in this model. Interestingly, combinatorial remedy with anti-LAP and anti-CD103 did not lead to a synergistic therapeutic impact indicating that LAP…
Mia. All lung metastatic lesions had regressed soon after two cycles (Fig. 3B), plus a comprehensive response (CR) was confirmed after six cycles (Fig. 3C). Though the patient continued to…
Itinib) and seven cancer types (Clear Cell Renal Cell Carcinoma, Colon cancer, Lung adenocarcinoma, non-Hodgkin Lymphoma, Lung Adenocarcinoma, Thyroid cancer and Sarcoma) using the offered clinical trials information for the…
E, a unique oil-in-water stable emulsion (SE) elicits higher HA titers when formulated with the synthetic TLR4 agonist, glucopyranosyl lipid adjuvant (GLA).86 These information suggest that alum could give a…
Ue to greater volume of polymer readily available to drug to accommodate excessive drugs. Secondly, it may be illustrated by enhanced viscosity of droplets (Shah and Pathak, 2010; Mao et…
E feasible threshold of post-tw ACT was 262 seconds, we further separated these filters as outlined by the 262 seconds of post-tw ACT (61 filters with 262 seconds of post-tw…
Be supported by neighborhood disorder, almost certainly additional for initiation of degradation than modification (29). In human cells, the web sites of polyubiquitination are drastically a lot more disordered, probably…
Ketball, soccer) was assessed at baseline and summed to provide the total quantity of hours spent in every category of activity per week. Neither variable incorporated hand-intensive aerobic activity (ie,…
Ancreas. J Korean Surg Soc. 2011;81 Suppl 1:S693. 3. Xu J, Zhang T, Wang T, You L, Zhao Y. Clinical traits and prognosis of principal leiomyosarcoma with the pancreas: a…
Ion in between ACh and modulation of NOS inside the retina is sparse and conflicting. As an example, oxotremorine increases immunoreactive cGMP by way of mAChR M2 in salamander retina35,…
Arallel, the levels of IFN- 1 mRNA and protein have been determined by quantitative RT/PCR and ELISA, respectively (B). The data show benefits pooled from at the least three independent…
D RNA/DNA double helices can improve their hydrogen bonding potential, when compared with the gas phase optimized complexes (72). In search of energetically favored structures displaying base pairing in between…
Lso showed no toxicity as determined by lactate dehydrogenase (LDH) released into media right after 24 h of drug remedy at one hundred or 400 M concentrations in MDM. By…
Rvival bene t to patients no longer responding to TKI therapy. Clearly, the roles of TKIs and surgery for enhancing survival in sufferers with recurrent GIST are certainly not mutually…
Tumor microenvironment is spatially and temporally heterogeneous. The accessibility of oxygen and nutrients depends on the proximity on the cells to blood vessels and can identify their basal metabolic state.…
Markedly comparable to the dose-dependent activation of caspase 3, indicating three, indicating that enhanced, increased, comparable to the dose-dependent activation of caspase that cytochrome c cytochrome c may be released…
According to the location from the prior Fx Hip Fx: probability multipliers provided prior hip, vertebral, or wrist Fx. Vertebral Fx: probability multipliers provided prior vertebral or wrist Fx Wrist…
E for either i HA or NP by flow cytometry were regarded as infected. Information from 4 independent experiments had been normalized to manage for distinctive percentages of infection between…
Ies/mL) and 201 cells/mm3 (IQR, 4933 cells/mm3). Major PI resistance-associated mutations (RAMs) have been demonstrated in 44 (51 ) non-nucleoside reverse transcriptase inhibitor RAMs in 72 patients (83 ) and…
Nicely in a six-well plate and incubated with vemurafenib (500 nM) and/or IFN-2b (ten 000 IU/mL). Untreated cells have been employed as a control. Dimethyl sulfoxide (DMSO; vehicle of vemurafenib)…
Inside the observed outcomes. As a result, we measured total protein carbonylation in exercised muscle tissues. As expected, atg7 null muscle tissues showed more carbonylated proteins than exerciseFigure four. Autophagy…
Ferences less than -12.5 or greater than 12.five using the objective of drawing restraints into the -12.5 to +12.five range (Fischer et al., 2015). Benchmark setup To evaluate the influence…
Oc testing. One-tailed P values 0.05 were deemed substantial. MOG recall T-cell assays had been evaluated with nonparametric t test. One-tailed P values 0.05 have been considered considerable. Study Approval…
Ect. Additionally, the administration of typical silymarin (50 mg/kg) considerable (p 0.05) attenuated the oxidative harm in CCl4 induced liver injury (Fig. 1a ).g/ml) + CCl4 (1 v/v) g/ml) +…
The 11b position becoming lost. The resulting cortisone (d3-cortisone) would possess a mass 1 Da less than that in the d4-hydrocortisone. Subsequent conversion of cortisone by way of 11b-hydroxysteroid dehydrogenase…
Ween Stub1 and APP in vivo was previously described (85). CRL4CRBN E3 ligase complex subunits and Stub1 bind to two distinct and non-overlapping domains of your APP intracellular domain: the…
And better handling qualities than MTA . CEM has demonstrated to manage root resorption and stimulate dentinal bridge formation . This case report describes the clinical and radiographic outcomes of…
Intense cholangiocyte proliferation within the course of ADPKD was confirmed by immunofluorescence, where we initially colocalized FSHR with PCNA (Fig. 4A) then FSHR with pERK (Fig. 4B). In cystic cholangiocytes,…
Oth the 5′ and 3′ untranslated regions (UTR) of Nrf2 mRNA contain regulatory elements that control Nrf2 translation. Specifically, the 5′ UTR of Nrf2 has an internal ribosome entry web…
0.1 0.2 0.1 0.1 0.1 Y 94 93 100 98 92 97 95 84 100 three 4 2 two three 2 3 two four thrombin IC50 (g/mL) 403c 381 500…
Ants on sterilized cucumber fragments. The photographs have been taken immediately after 10 days of incubation on sterilized cucumber fragments. (B) Quantification of conidia for each and every strain. The…
Soon after fluid percussion injury. The tonic release of dopamine was reversed by the amantadine treatment two weeks right after fluid percussion injury (Fig. 1C), along with the mean worth…
Ession to evaluate cell death in the Bcell population. (A) Contour maps in the flowcytometric evaluation of two representative CLL samples incubated with 50 g/mL mAb for 24 h. The…
F they have a motor tic, they’re asked in regards to the presence of more motor tics. Next, respondents are asked regarding the presence of phonic tics. Chronicity (i.e., frequency,…
Tors on KB31 cells and found that neither LMB9 which targets Lewis Y antigen, or BL22 which targets CD22, had any toxic activity (Fig. 3G and H), demonstrating that knock…
Ns of Kenya. International journal of cancerJournal international du cancer 2007, 120:12127. Moormann AM, Chelimo K, Sumba OP, Lutzke ML, PloutzSnyder R, Newton D, Kazura J, Rochford R: Exposure to…
By neurons and thought to hold CX3CR1 receptorbearing microglia in a quiescent state (Cardona et al., 2006). Unlike the other chemokines examined, CX3CL1 showed a high level of constitutive expression,…
El were plasma PIIINP and MMP8. Matrix turnover goods might be incorporated into a multianalyte panel to determine sufferers with pulmonary tuberculosis. Abbreviations: AUC, location below the curve; BMI, body…
Ed mechanisms of action that demand their incorporation into DNA. As soon as incorporated, 5aza nucleotides act as suicide inhibitors, which trap DNMT isozymes in covalent DNAprotein complexes which are…
Ied a distinct isoform of Hdac7 as a positive regulator of TLR responses in macrophages. had been cultured in DMEM (Invitrogen) supplemented with 10 FCS, 20 units/ml penicillin, 20 units/ml…
In involving (r’ = r , exactly where r would be the actual metalscatterer distance and can be a phase shift of 0.four . Initial analysis on the EXAFS information…
Was approved by the United states Meals and Drug Administration in 2010 for the remedy of many sclerosis (70). As well as its immunomodulatory effects, FTY720 also decreased vascular permeability,…
E all been noted as compatible solutes that accumulate intracellularly and enable the organism to develop in highosmolality media (4, 13). Various transport activities have been reported as prospective contributors…
Bohydrate degrading enzymes from other organisms, are classified in diverse glycoside hydrolase (GH) families in accordance with the classification method of Henrissat and coworkers . The classification is determined by…
K.L. analyzed information; M.L.D. and W.E.H. wrote the paper; K.L., M.K.H., S.M.T., and C.L.E. edited the paper.of generally slowturnover protein populations. This establishes the presence of numerous kinetic pools of…
S are known to lead to vascular proliferation, inflammation and damage with the blood vessels,19 which may possibly explain the uncommon presentations of prominent vascular changes in our case. All…
E active (GTP bound) kind of RhoA and, as a result, can be made use of to evaluate levels of RhoA activation.32,35 A construct containing the active portion of the…
Fics towards the membrane for the reason that from the WT subunit and can be lightgated for the reason that of MAQ attachment for the TREK1PCS. (C,D) Wholecell recording from…
Ere avidly (12, 35, 72). As a result, the enhanced surface area, collectively with an enhanced number of binding web sites, offers a plausible explanation for enhanced S. mutans carriage…
Ll images have been documented making use of an Olympus 1X70 microscope and analyzed using Q Capture Pro software program (Media Cybernetics). Photos were generated making use of Adobe Photoshop…
, as well as mapping of your activating/inactivating mutations around the homology model are in agreement having a LapDlike activating mechanism, solely according to the interaction between YfiR and YfiN…
E by measuring the density of bands utilizing Image J computer software. Array comparative genomic hybridization (CGH) and information evaluation. An array CGH was performed following the standard Agilent protocol…
S of utilizing tri/dicalcium silicates broadly fit into 3 categories: vital pulp therapy, endodontic restoration and endodontic sealing. Sealing and obturation of teeth using tri/dicalcium silicates will continue to adjust…
Orldwide for sewage treatment are in India. The fundamental method towards choice of technologies for sewage remedy is low capital fees, low power requirements, low operation and upkeep (O M)…
3) (three) (7) RA repressed RXR KO induced two 0 0 1 0 0 0 four two (four) (two) (1) (2)Lipid droplet growth Transportation of bile aicds for bile excretion…
95 loci, the combined effects of which combined effects account for approximately 102 of your total variance in HDLC and triglyceride levels7. The Action for Health in Diabetes (Look AHEAD)…
Ducts of cell membrane lipid peroxidation by reactive oxygen species (ROS) and are thought of a trustworthy marker of oxidative stressinduced cell harm. Thiobarbituric acidreactive substances were determined by measurement…
Em from anaerobic glycolysis and a low final pH happen to be have already been related with softness , possibly as a consequence of lowered connective tissue strength , denaturation…
Instances higher, as a result confirming mDCs as a optimistic handle. The collected supernatants of cocultivated cells infected with H1PV showed higher levels of IFN, TNF, and IL6 in comparison…
In Ayurvedic program of medicine, the leaves and roots are made use of inside the treatment of indolent ulcers (Kirtikar and Basu,) and diarrhea (Amresh et al.,). The plant is…
Ons (Weng et al., 2012). We thus analyzed the chromatin organization within TLR9 promoter in mock or 16QsVinfected cells by monitoring Histone four acetylation (AceH4) and trimethylation of histone H3…
Concentrations of P, K, Mg, Cu, and Zn had been comparable in all samples. An more statistical evaluation was carried out with all the peach tree data, taking into account…
Ty of New York, New York, New YorkPhosphatidic acid (PA) is actually a crucial metabolite in the heart of membrane phospholipid biosynthesis. However, PA also serves as a essential lipid…
On coefficient of M1 was not different within the absence or presence of glucose. To be able to exclude the possibility that the cells’ exposure with high glucose concentrations altered…
Rating the 1423pT sequence. (C) Identical sequences of mature human and murine miRNA1423p (accession nos. MIMAT0000434 and MIMAT0000155, respectively). (D) 1423pT sequence inserted in to the pAC3GFP vector to create…
S had been derived from the predictive equations according to linear regression equations among RF values of target standard compounds (Table 3S) and their powerful carbon numbers (ECNs). The ECN…
Arabidopsis thaliana AtTIP1;two and AtPIP2;1 (plasma membrane intrinsic protein 21) to test the relevance of different selectivity filters, and their outcomes did not help the proposition that an Arg/His pair…
), the VICC P30CA68485 as well as the DDRC DK58404. We would like to thank Dr. Indicates for critically reviewing the manuscript. Staphylococcus aureus is definitely the major lead to…
Cant enhance in latency time using the Barnes maze test, indicating memory impairment, which was further enhanced by fructose intake. The effects of fructose on memory inside the omega3 deficient…
N. A DAB kit (Sigma Diagnostics, USA) was made use of for chromogen detection. The major antibodies were replaced by rabbit serum as a manage. The staining intensity in epithelial…
2012). Rolipram was capable to restore RBF to Sham levels within 30 minutes, paralleling the acute restoration of cortical capillary perfusion. This boost in RBF was likely due to the…
28.4 five.5 0.9 four.6 2.eight five.five 15.six 1.eight 3.7 14.7 9.two 10.1 2.eight eight.three 4.six six.4 1.8 11.0 11.0 17.four 7.three 7.three 0.9 8.3 six.4 12.8 four.6 6.4 1.eight 109)…
GCCTTTACCTG CTCGAGTTGCTGGTCACGCAGGAAGG26For the abbreviations utilized inside the E. coli genotypes, see reference 58.igardefordensis DPN7T sucCD had been cultivated at 30 in mineral salt medium (MSM) (35) containing 20 mM gluconate,…
949301. 50 Schuler G, SchulerThurner B, Steinman RM. The use of dendritic cells in cancer immunotherapy. Curr Opin Immunol 2003; 15:1387. Redox Biology two (2014) 273Contents lists out there at…
Ysis and not an intentiontotreat evaluation. We carried out a secondary analysis to examine longterm mortality after stroke utilizing an intentiontotreat approach which includes all individuals by their assigned remedy…
Soluble VEGF receptor1 combined with all the release of growth variables belonging to the transforming development element beta (TGFb) superfamily enhanced cartilage regeneration in each rat osteoarthritic10 and osteochondral defect…
Ication chain of manufacturing, ordering, prescribing, dispensing, administering, and monitoring ought to take part in the medication takeback procedure. Distribution entities contain wholesale distributors and companies. Dispensing entities involve all…
S 2.22, 2H, s 1.63, 2H, s 1.63, 2H, s 1.63, 2H, s 1.35.30,49H, s 1.35.30, 49H, s 1.35.30, 49H, s 0.93, 3H, t, (six.6) 0.93, 3H, t, (6.6) (6.6)…
Alues ,0.05 have been regarded statistically important.Benefits CT1 induces MMP1 gene expressionWe initial investigated irrespective of whether CT1 induces MMP1 mRNA expression in HAECs. HAECs had been treated for 24…
In crude extracts. Total protein was isolated from cultures grown to an OD600 of 0.5, 1.0 and centrifuged for 5 min at 12,000 g. The aque2.0 of your strains wildtype…
TPinduced currents by suggests of your steadystate protocol (Figure 2A, D). In the very same series of experiments, the recovery from desensitizationPLOS A single | www.plosone.orgMarkov Model of Competitive Antagonism…
R to MTS metabolism. There were very couple of cells left when treated with 7.five or 10M 6OHPBDE47 for 48 h. The EC50 on cell quantity reduction was also about…
Or prevention of HIV infection in those situations which have many sex partners. A perfect microbicide should really effectively inhibit transmission of pathogens causing STIs even though resulting in minimal…
D a longstanding interest in estrogens. “It will likely be simple” he mentioned. “You will extract and purify the rat uterine ER and crystallize it with an estrogen and an…
Oronary syndromes. The objective of your present study was to characterize a possible riskadjusted difference in transfusion needs among prasugrel and clopidogrel cohorts. MethodsThe information from 422 patients undergoing isolated…
Y. As a result S. pyogenes Scl2 derived collagen, lacking any terminal domains, has been shown to become noncytotoxic in cell culture (Fig. three) working with mouse L929 cells and…